BBa_K165006 1 BBa_K165006 Zif268-HIV DNA-binding domain 2008-10-25T11:00:00Z 2015-05-08T01:10:55Z - - false false _267_ 0 2512 58 It's complicated true - false John Szymanski BBa_K880003 1 BBa_K880003 Asymmetrically digestible reporter, same orientation of inverted repeats as K137058 (external sites 2012-09-28T11:00:00Z 2015-05-08T01:13:40Z Enter source here. -IRL K137010 + Sequence with AgeI cut-site K165006 + IRR K137008 Mi8 -Asymmetrically digestible reporter, same orientation of inverted repeats as K137058 (external sites located internally of flip region)(IRL - ???flip region??? - IRR) false false _1142_ 0 9403 9 It's complicated false Enter design considerations. false Josh Atkinson, Mike Ferguson, and Ben Parker component2204522 1 BBa_K137008 component2204519 1 BBa_K165006 component2204518 1 BBa_K137010 annotation2204519 1 BBa_K165006 range2204519 1 44 295 annotation2204518 1 BBa_K137010 range2204518 1 1 35 annotation2204522 1 BBa_K137008 range2204522 1 304 338 BBa_K137008 1 IRR fimE IRR 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z pFIP plasmid fimE inverted repeat right recombination site false false _187_ 0 3112 9 It's complicated false none false Allen Lin annotation1963842 1 IRR in range1963842 1 19 35 annotation1963841 1 IRR out range1963841 1 1 17 BBa_K137010 1 fimE IRL fimE IRL 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z pFIP plasmid fimE inverted repeat left recombination site false false _187_ 0 3112 9 It's complicated false none false Allen Lin annotation1963843 1 IRL in range1963843 1 1 17 annotation1963844 1 IRL out range1963844 1 19 35 BBa_K137010_sequence 1 tctatgagtcaaaatggccccaattgtcttgtatt BBa_K880003_sequence 1 tctatgagtcaaaatggccccaattgtcttgtatttactagagcccttccagtgtcgcatttgcatgcggaacttttcgctcaggacggaccttgacaggcatacccgtactcataccggtgaaaaaccgtttcagtgtcggatctgtatgcgaaatttctccctcagccagaccttgcgccgccatctacgtacgcacaccggcgagaagccattccaatgccgaatatgcatgcgcaacttcagtctcaggagcaacctggggcggcacctaaaaacccacacaggagaaaaatactagagaagatgaaacatttggggccaaactgtccatatta BBa_K165006_sequence 1 cccttccagtgtcgcatttgcatgcggaacttttcgctcaggacggaccttgacaggcatacccgtactcataccggtgaaaaaccgtttcagtgtcggatctgtatgcgaaatttctccctcagccagaccttgcgccgccatctacgtacgcacaccggcgagaagccattccaatgccgaatatgcatgcgcaacttcagtctcaggagcaacctggggcggcacctaaaaacccacacaggagaaaaa BBa_K137008_sequence 1 aagatgaaacatttggggccaaactgtccatatta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z