BBa_K880004 1 BBa_K880004 LVA Tag in RFC25 2012-09-28T11:00:00Z 2015-05-08T01:13:40Z Reference: Andersen et al. Appl Environ Microbiol. 1998 June; 64(6): 2240???2246. The amino acid sequence AANDENYALVA can be fused onto proteins in order to rapidly reduce their half life in the cytoplasm. Responsiveness for genetic circuits can be improved by c-terminal fusions of this short, handy sequence. This part possesses an RFC25 prefix to facilitate in-frame translation. Reference: Andersen et al. Appl Environ Microbiol. 1998 June; 64(6): 2240???2246. false false _1142_ 0 9403 9 In stock false The part is in RCF25. false Josh Atkinson, Mike Ferguson, and Ben Parker BBa_K880004_sequence 1 gctgcaaacgacgaaaactacgctttagtagcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z