BBa_K883000 1 BBa_K883000 CCMV wt coat protein coding 2012-09-22T11:00:00Z 2015-05-08T01:13:40Z this part's source is an pET28 vector provided by Dr. Kormelink from the Virology group of the Wageningen UR CCMV is an abriviation of the Cowpea Chlorotic Mottle Virus, one of the most studied viruses in producing Virus Like Particles (VLPs). This part is the coding sequence of the coat protein of the CCMV virus. When expressed in ''Escherichia coli'', these coat proteins can be harvested and be assembled in vitro using the Wageningen_UR iGEM 2012 protocols (http://2012.igem.org/Team:Wageningen_UR/Protocol/StartupCCMV) . This part is provided for the iGEM community so that they can use this part to be integrated in an own expression biobrick (e.g. BBak883001) to produce these VLPs for their one own use, including but not limited to packaging, making fusion proteins to the N/C terminal. This all for to be used in a wide variety of applications. for ideas what kind of applications can be mediated with CCMV VLPs, check http://2012.igem.org/Team:Wageningen_UR/Applications false false _1146_ 0 12652 9 It's complicated false none false Jeroen Bosman annotation2194173 1 stop codon range2194173 1 571 573 annotation2194171 1 start range2194171 1 1 3 annotation2194172 1 CCMV coat protein range2194172 1 1 570 BBa_K883000_sequence 1 atgggtacagtcggaacagggaagttaactcgtgcacaacgaagggctgcggcccgtaagaacaagcggaacactcgtgtggtccaacctgttattgtagaacccatcgcttcaggccaaggcaaggctattaaagcatggaccggttacagcgtatcgaagtggaccgcctcttgtgcggctgccgaagctaaagtaacctcggctataactatctctctccctaatgagctatcgtccgaaaggaacaagcagctcaaggtaggtagagttttattatggcttgggttgcttcccagtgttagtggcacagtgaaatcctgtgttacagagacgcagactactgctgctgcctcctttcaggtggcattagctgtggccgacaactcgaaagatgttgtcgctgctatgtaccccgaggcgtttaagggtataacccttgaacaactcaccgcggatttaacgatctacttgtacagcagtgcggctctcactgagggcgacgtcatcgtgcatttggaggttgagcatgtcagacctacgtttgacgactctttcactccggtgtattag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z