BBa_K883000 1 BBa_K883000 CCMV wt coat protein coding 2012-09-22T11:00:00Z 2015-05-08T01:13:40Z this part's source is an pET28 vector provided by Dr. Kormelink from the Virology group of the Wageningen UR CCMV is an abriviation of the Cowpea Chlorotic Mottle Virus, one of the most studied viruses in producing Virus Like Particles (VLPs). This part is the coding sequence of the coat protein of the CCMV virus. When expressed in ''Escherichia coli'', these coat proteins can be harvested and be assembled in vitro using the Wageningen_UR iGEM 2012 protocols (http://2012.igem.org/Team:Wageningen_UR/Protocol/StartupCCMV) . This part is provided for the iGEM community so that they can use this part to be integrated in an own expression biobrick (e.g. BBak883001) to produce these VLPs for their one own use, including but not limited to packaging, making fusion proteins to the N/C terminal. This all for to be used in a wide variety of applications. for ideas what kind of applications can be mediated with CCMV VLPs, check http://2012.igem.org/Team:Wageningen_UR/Applications false false _1146_ 0 12652 9 It's complicated false none false Jeroen Bosman annotation2194172 1 CCMV coat protein range2194172 1 1 570 annotation2194171 1 start range2194171 1 1 3 annotation2194173 1 stop codon range2194173 1 571 573 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J04500 1 BBa_J04500 IPTG inducible promoter with RBS 2005-06-08T11:00:00Z 2015-08-31T04:08:14Z Davidson Synth-Aces Released HQ 2013 R0010.B0034 false true _16_ 0 326 16 In stock false false Kristen DeCelle component1508149 1 BBa_R0010 component1508159 1 BBa_B0034 annotation1508149 1 BBa_R0010 range1508149 1 1 200 annotation1508159 1 BBa_B0034 range1508159 1 209 220 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961227 1 start range1961227 1 173 173 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 BBa_K883001 1 BBa_K883001 CCMV wt coat protein under IPTG induced promoter 2012-09-22T11:00:00Z 2015-05-08T01:13:40Z this part is created with a part from the parts registry, and a part made by Wageningen_UR 2012 with the template of Dr. Kormelink komt nog false false _1146_ 0 12652 9 It's complicated false none false Jeroen Bosman component2194182 1 BBa_J04500 component2194186 1 BBa_K883000 annotation2194182 1 BBa_J04500 range2194182 1 1 220 annotation2194186 1 BBa_K883000 range2194186 1 227 799 BBa_K883001_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgggtacagtcggaacagggaagttaactcgtgcacaacgaagggctgcggcccgtaagaacaagcggaacactcgtgtggtccaacctgttattgtagaacccatcgcttcaggccaaggcaaggctattaaagcatggaccggttacagcgtatcgaagtggaccgcctcttgtgcggctgccgaagctaaagtaacctcggctataactatctctctccctaatgagctatcgtccgaaaggaacaagcagctcaaggtaggtagagttttattatggcttgggttgcttcccagtgttagtggcacagtgaaatcctgtgttacagagacgcagactactgctgctgcctcctttcaggtggcattagctgtggccgacaactcgaaagatgttgtcgctgctatgtaccccgaggcgtttaagggtataacccttgaacaactcaccgcggatttaacgatctacttgtacagcagtgcggctctcactgagggcgacgtcatcgtgcatttggaggttgagcatgtcagacctacgtttgacgactctttcactccggtgtattag BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_J04500_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa BBa_K883000_sequence 1 atgggtacagtcggaacagggaagttaactcgtgcacaacgaagggctgcggcccgtaagaacaagcggaacactcgtgtggtccaacctgttattgtagaacccatcgcttcaggccaaggcaaggctattaaagcatggaccggttacagcgtatcgaagtggaccgcctcttgtgcggctgccgaagctaaagtaacctcggctataactatctctctccctaatgagctatcgtccgaaaggaacaagcagctcaaggtaggtagagttttattatggcttgggttgcttcccagtgttagtggcacagtgaaatcctgtgttacagagacgcagactactgctgctgcctcctttcaggtggcattagctgtggccgacaactcgaaagatgttgtcgctgctatgtaccccgaggcgtttaagggtataacccttgaacaactcaccgcggatttaacgatctacttgtacagcagtgcggctctcactgagggcgacgtcatcgtgcatttggaggttgagcatgtcagacctacgtttgacgactctttcactccggtgtattag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z