BBa_K883160 1 BBa_K883160 CCMV_Negative coat protein 2012-09-18T11:00:00Z 2015-05-08T01:13:40Z Modified from CCMV wild-type. This construct produces CCMV core antigen subunits. The subunits have been modified in such a way that they will fold into CCMV Virus-Like Particles that have a negative interior. This was done by replacing 6 Arginine and 3 Lysine residues at the N-Terminus with Glutamic acid residues. The full protocol for this construct can be found on the Wageningen_UR 2012 Wiki. false false _1146_ 0 9618 9 It's complicated false In nature, wild-type CCMV Virus Particles have a positive interior to which RNA molecules attach. To be able to load the CCMV VLPs with positively charged molecules, e.g. metals, we have re-designed the N-Terminus of the core antigen subunits to contain 9 negatively charged amino acids instead of 9 positively charged amino acids. false Hugo de Vries annotation2187438 1 CCMV with negative N-terminus range2187438 1 1 578 BBa_K883160_sequence 1 atgggtacagtcggaacaggggaacttacggaagctcaagaagaagctgctgctgaagaaaacgaagaaaacacggaagtggtccaacctgttattgtagaacccatcgcttcaggccaaggcaaggctattaaagcatggaccggttacagcgtatcgaagtggaccgcctcttgtgcggctgccgaagctaaagtaacctcggctataactatctctctccctaatgagctatcgtccgaaaggaacaagcagctcaaggtaggtagagttttattatggcttgggttgcttcccagtgttagtggcacagtgaaatcctgtgttacagagacgcagactactgctgctgcctcctttcaggtggcattagctgtggccgacaactcgaaagatgttgtcgctgctatgtaccccgaggcgtttaagggtataacccttgaacaactcaccgcggatttaacgatctacttgtacagcagtgcggctctcactgagggcgacgtcatcgtgcatttggaggttgagcatgtcagacctacgtttgacgactctttcactccggtgtattagtgaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z