BBa_K883401 1 BBa_K883401 PLRV Coat Protein gene under IPTG induced promotor 2012-10-24T11:00:00Z 2015-05-08T01:13:40Z The coding sequence for this part was isolated from a total RNA sample from an Agria potato leaf. This part consists of BBa_J04500 (IPTG inducible promotor + RBS) and the coding sequence for the major coat protein of the Potato Leafroll Virus (PLRV). This sequence was isolated from a PLRV-infected Agria potato leaf by iGEM team Wageningen UR 2012. This was done by cDNA synthesis followed by PCR. The PLRV major Coat Protein should be capable of forming a Virus-Like Particle, but this was not (yet) confirmed for this part. This gene was isolated from potato leaf roll virus (PLRV) infected plants. The obtained sequence of the coding gene is 100% identical to several PLRV isolates available in the NCBI database. Expression of a similar viral coat proteins was performed by the iGEM2012 team of Wageningen UR, strongly suggesting that this part can be expressed in E. coli as well. In the figure below, the predicted 3 dimensional structure can be seen. The coat proteins will form a icosahedral shaped Virus Like Particle (VLP) with a radius of about 11,5 nm composed of 180 coat proteins. false false _1146_ 0 13437 9 Not in stock false Not applicable false Marnix Vlot annotation2212604 1 IPTG inducible promotor range2212604 1 1 220 annotation2212603 1 PLRV Coat Protein range2212603 1 227 853 BBa_K883401_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgagtacggtcgtggttaaaggaaatgtcaatggtggtgcacaacaaccaagaaggcgaagaaggcaatcccttcgcaggcgcgctaacagagttcagccagtggttatggtcacggcccctgggcaacccaggcgccgaagacgcagaagaggaggcaatcgccgctcaagaagaactggagttccccgaggacgaggctcaagcgagacattcgtgtttacaaaggacaacctcatgggcaactcccaaggaagtttcaccttcgggccgagtctatcagactgtccggcattcaaggatggaatactcaaggcctaccatgagtataagatcacaagcatcttacttcagttcgtcagcgaggcctcttccacctcctccggttccatcgcttatgagttggacccccattgcaaagtatcatccctccagtcctacgtcaacaagttccaaattacgaagggcggcgccaaaacttatcaagcgcggatgataaacggggtagaatggcacgattcttctgaggatcagtgccggatactgtggaagggaaatggaaaatcttcagataccgcaggatccttcagagtcaccatcagggtggctttgcaaaaccccaaatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z