BBa_K886000 1 BBa_K886000 Fixed lox71 2012-09-23T11:00:00Z 2015-05-08T01:13:40Z primers Released HQ 2013 The particularity of lox71 is that it has an altered sequence at the end of it's right arm compared to loxP. This sequence variation reduces affinity of the Cre recombinase for the arm. false false _1149_ 0 11298 9 In stock false Based on the report made by the igem2010 UT-Tokyo team and some papers, the lox71 (BBa_I718017) from the registry was wrong, it had a cg instead a gc in its center sequence that is between the arms. Apparently, this part was corrected by the iGEM11_WITS_CSIR_SA team (BBa_K537020), but the sequence from this group had the same error. The corrected part from iGEM11_Tokyo_Tech (BBa_K649205) was right but no DNA was available in the registry. So we decided to synthesized it and test it, using the proper sequence described by http://www.ncbi.nlm.nih.gov/pmc/articles/PMC137435/, and we submitted the correct DNA to the Registry. false edgar andres ochoa cruz BBa_K886000_sequence 1 taccgttcgtatagcatacattatacgaagttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z