BBa_K887011 1 BBa_K887011 DNA program : specific DNA sequence which can be recognized by zinc fingers 2012-09-15T11:00:00Z 2015-05-08T01:13:40Z no We use this DNA program to make a scaffold, which the enzymes fused with the Z finger can bind on it. By this way, each enzyme can react with the substrate easily, and thus enhance the yield of the isobutanol. false false _1150_ 0 14117 9 It's complicated false no false Yu, CHIEH-CHENG annotation2183903 1 BBa_K323066 range2183903 1 1 70 annotation2183901 1 ZNF_HIVC_O range2183901 1 45 53 annotation2183902 1 Gli1_O range2183902 1 56 69 annotation2183899 1 Zif268_O range2183899 1 23 31 annotation2183898 1 Blues_O range2183898 1 12 19 annotation2183900 1 PBSII_O range2183900 1 34 42 annotation2183897 1 Jazz_O range2183897 1 1 8 BBa_K887011_sequence 1 gctgctgcggtgtttggatggagcgtgggcggggtgtggaaattgatgctgcattgaccacccaagacga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z