BBa_K891000 1 BBa_K891000 GFPT1 2012-10-01T11:00:00Z 2015-05-08T01:13:40Z It comes from genomic GFP in E.coli Keio strains. This part should be paired with GFPT2. This part codes for a 20bp sequence that is complementary to a portion of the genomic GFP coding sequence in E.coli Keio strains. false false _749_1155_1205_ 0 10429 9 In stock true Blasted sequence against parent strains and identified a region with high specificity. Needs to be absent of YCCTT motifs. false Ryan Muller annotation2210386 1 Topo binding site range2210386 1 26 30 annotation2210385 1 Topo binding site range2210385 1 1 5 annotation2210388 1 GFPT1 recogniton probe range2210388 1 6 30 annotation2210389 1 GFPT1 recogniton probe range2210389 1 31 55 annotation2210387 1 Topo binding site range2210387 1 51 55 BBa_K891000_sequence 1 cccttgccctgtccttttaccagaccccttgccctgtccttttaccagacccctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z