BBa_J176130 1 BBa_J176130 PLflex4 2011-10-27T11:00:00Z 2015-08-31T04:08:35Z TBA 4x peptide linker, flexible; (GGGGS)16 false false _863_ 0 10865 9 Not in stock false TBA false Karmella Haynes annotation2176038 1 PLflex range2176038 1 181 240 annotation2176037 1 PLflex range2176037 1 121 180 annotation2176035 1 PLflex range2176035 1 1 60 annotation2176036 1 PLflex range2176036 1 61 120 BBa_J61100 1 BBa_J61100 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A {{JCA_Arkin_RBSFamily}} false true _95_ 0 483 95 In stock false N/A true John Anderson BBa_J176040 1 PLflex PLflex 2011-09-28T11:00:00Z 2015-08-31T04:08:33Z TBA Flexible linker peptide made of two GGGGS repeats false false _863_ 0 10865 9 Not in stock false TBA false Karmella Haynes annotation2176039 1 GGGGS range2176039 1 1 15 annotation2176041 1 GGGGS range2176041 1 31 45 annotation2176042 1 GGGGS range2176042 1 46 60 annotation2176040 1 GGGGS range2176040 1 16 30 BBa_I732006 1 lacZ-alpha lacZ alpha fragment 2007-07-06T11:00:00Z 2015-08-31T04:07:56Z PCR amplified from BBa_J33202 without the RBS. Released HQ 2013 In strains with lacZ-omega (lacZ N-terminal deletion mutant) like DH5alpha, DH10B and Top10, lacZ-alpha restores the beta-galactosidase activity. false true _156_ 0 1557 9 In stock false None true Zhan Jian annotation1936905 1 START range1936905 1 1 3 annotation1936906 1 STOP range1936906 1 229 234 annotation1936904 1 lacZ range1936904 1 1 234 BBa_K891002 1 BBa_K891002 Probe coding for alpha fragment of beta gal (long linker) 2012-10-02T11:00:00Z 2015-05-08T01:13:41Z Working unit constructed using parts in the registry. The following part consists of a constitutive promoter plus RBS (BBa_J61100), which codes for the protein Streptavidin linked to the alpha fragment of Beta Galactosidase via a longer flexible Linker (BBa_J176130). true false _1155_ 0 10544 9 Discontinued false The part works only with its omega compliment or can also be expressed if transformed in cells that code for the omega fragment of Beta Galactosidase. false Abhinav Markus component2210760 1 BBa_J61100 component2210774 1 BBa_I732006 component2210765 1 BBa_J176040 component2210770 1 BBa_J176130 annotation2210774 1 BBa_I732006 range2210774 1 335 568 annotation2210770 1 BBa_J176130 range2210770 1 89 328 annotation2210760 1 BBa_J61100 range2210760 1 1 12 annotation2210765 1 BBa_J176040 range2210765 1 21 80 BBa_J176040_sequence 1 ggcggtggcggatctggaggtggtggttcaggcggaggcggatctggaggaggtggttca BBa_K891002_sequence 1 aaagaggggacatactagagggcggtggcggatctggaggtggtggttcaggcggaggcggatctggaggaggtggttcatactagagggcggtggcggatctggaggtggtggttcaggcggaggcggatctggaggaggtggttcaggaggtggtggttctggcggaggcggttcaggcggtggtggatctggaggaggcggttcaggaggaggtggttctggcggtggcggatcaggaggtggcggatctggcggaggcggatcaggcggaggcggttctggaggtggcggatcaggcggtggtggatcaggaggaggcggttcttactagatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtaataa BBa_J61100_sequence 1 aaagaggggaca BBa_J176130_sequence 1 ggcggtggcggatctggaggtggtggttcaggcggaggcggatctggaggaggtggttcaggaggtggtggttctggcggaggcggttcaggcggtggtggatctggaggaggcggttcaggaggaggtggttctggcggtggcggatcaggaggtggcggatctggcggaggcggatcaggcggaggcggttctggaggtggcggatcaggcggtggtggatcaggaggaggcggttct BBa_I732006_sequence 1 atgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z