BBa_K891999 1 BBa_K891999 GFPT2 2012-10-01T11:00:00Z 2015-05-08T01:13:41Z It comes from genomic GFP in E.coli Keio strains. This part should be paired with GFPT1. This part codes for a 20bp sequence that is complementary to a portion of the genomic GFP coding sequence that comes after the GFPT1 binding site in E.coli Keio strains. false false _749_1155_1205_ 0 10429 9 In stock true Blasted sequence against parent strains and identified a region with high specificity. Needs to be absent of YCCTT motifs and AAGGR. false Ryan Muller annotation2210697 1 Topo binding site range2210697 1 51 55 annotation2210699 1 GFPT2 recognition probe range2210699 1 31 55 annotation2210698 1 GFPT2 recognition probe range2210698 1 6 30 annotation2210696 1 Topo binding site range2210696 1 26 30 annotation2209518 1 Topo binding site range2209518 1 1 5 BBa_K891999_sequence 1 cccttacctgtccacacaatctgcccccttacctgtccacacaatctgccccctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z