BBa_K895000 1 Tat PROM Eco_Ptat2 2012-09-20T11:00:00Z 2015-05-08T01:13:41Z Amplified by PCR from BBa_K562000. Released HQ 2013 The constitutive promoter region (97 bp) from the Escherichia coli K-12 tatABCD (twin-arginine translocase) operon. This is a constitutive promoter that gives good levels of expression in E. coli, but is not inducible or repressible. The promoter region is cloned as an EcoRI / PstI fragment into pSB1C3 following Biobrick Standard [10]. This is a corrected part that replaces the BBa_K562000 biobrick. false false _1160_ 0 8083 9 In stock false The part has an engineered BamHI (5'-GGATCC-3') restriction site at the extreme 3' end. For best results, open reading frames should be cloned into this BamHI site with their ATG initiation codons immediately following it. This will place the ATG at exactly the correct distance from the native tatA RBS for optimal translational efficiency. false Frank Sargent BBa_K895000_sequence 1 tgtcggttggcgcaaaacacgctgattttttcatcgctcaaggcgggccgtgtaacgtataatgcggctttgtttaatcatcatctaccacagaggaggatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z