BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I765001 1 pUV UV promoter 2007-10-25T11:00:00Z 2015-08-31T04:08:09Z Genomic sequence This device is regulated by UV irradiation false false _118_ 0 2266 9 In stock false None true iGEM Colombian Team 2007 annotation1955941 1 promoter range1955941 1 1 76 BBa_K896905 1 BBa_K896905 a practiced part constructed by chenpowei 2012-04-25T11:00:00Z 2015-05-08T01:13:41Z promoter:BBa_I765001 Designed by iGEM Colombian Team 2007 cds: human genes Xq11-12 Promoter:an UV induced promoter cds:a testosterone-making gene false false _1161_ 0 12740 9 Not in stock false practice false Po-Wei Chen component2173904 1 BBa_K896951 component2173905 1 BBa_B0010 component2173901 1 BBa_I765001 component2173903 1 BBa_B0034 component2173907 1 BBa_B0012 annotation2173907 1 BBa_B0012 range2173907 1 547 587 annotation2173904 1 BBa_K896951 range2173904 1 103 450 annotation2173905 1 BBa_B0010 range2173905 1 459 538 annotation2173901 1 BBa_I765001 range2173901 1 1 76 annotation2173903 1 BBa_B0034 range2173903 1 85 96 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_K896951 1 BBa_K896951 produce testosterone 2012-04-25T11:00:00Z 2015-05-08T01:13:42Z human gene practice false false _1161_ 0 12740 9 Not in stock false practice false Po-Wei Chen BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K896951_sequence 1 atgaccactctgcgtgatgtagggaagccagggcaagacctgataacctcttttctcgatgatcttcatatatcagacctggatcccagagaccgtggagtaggggatctcaaacttgaccctaataaggggccggccctccacctcctttttctccactctagggaggccaaagtaggctcacatcaggtactccttgccccctcggaaggacttaatacttcaaataacgatgtttttctccagcacatacttggcgctgcacacgctggtcttcaggtgcgggagtcggcatcgttgggtatgggtacagacatctccacacattggccactgactgtttcttaa BBa_B0034_sequence 1 aaagaggagaaa BBa_K896905_sequence 1 ggcaggaagaccgggcgcatgagcgtattttgtttatctaatatgcctgaaagcgcataccgctatggagggggtttactagagaaagaggagaaatactagatgaccactctgcgtgatgtagggaagccagggcaagacctgataacctcttttctcgatgatcttcatatatcagacctggatcccagagaccgtggagtaggggatctcaaacttgaccctaataaggggccggccctccacctcctttttctccactctagggaggccaaagtaggctcacatcaggtactccttgccccctcggaaggacttaatacttcaaataacgatgtttttctccagcacatacttggcgctgcacacgctggtcttcaggtgcgggagtcggcatcgttgggtatgggtacagacatctccacacattggccactgactgtttcttaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I765001_sequence 1 ggcaggaagaccgggcgcatgagcgtattttgtttatctaatatgcctgaaagcgcataccgctatggagggggtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z