BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I712004 1 BBa_I712004 CMV promoter 2007-10-18T11:00:00Z 2015-08-31T04:07:45Z pcDNA3 by Invitrogen a constitutive expression promoter or use in mammalian cells. Ribosome binding site is included. false false _130_ 0 1896 9 It's complicated false Cloned into pSB1AC3 vector. false Andrej Ondracka BBa_K896919 1 BBa_K896919 Mediate Cellular Resistance 2012-04-26T11:00:00Z 2015-05-08T01:13:42Z Sus scrofa The human 1-8 interferon inducible gene family consists of at least 3 functional genes; 9-27, 1-8D and 1-8U, which are all linked on an 18-kb fragment of chromosome 11 and are highly homologous. It has recently been shown by us and others that the 1-8D gene is overexpressed in colon carcinoma. Here, we show, by sequence comparison of the 1-8D in pairs of tumor/normal colon tissues, the existence of 6 different alleles, containing single-nucleotide polymorphisms with no mutations. Transformation assays revealed a possible role for the 1-8D gene as a transformation inhibitor. Further, transient expression of the human 1-8D gene in multiple mammalian cell lines showed accumulation of cells in the G1 phase followed by elevation in the subG1 phase. SubG1 elevation was confirmed as apoptosis by Annexin-V binding assays and transferase-mediated dUTP nick end labeling assays. Moreover, knock-down of 1-8D provided partial protection from Etoposide and UV-induced apoptosis. The induction of apoptosis by 1-8D is dependent on caspase activities but not on p53 expression. Although 1-8D induces apoptosis independently of p53, p53 expression downregulates 1-8D protein expression. Our data suggest a role for the 1-8D gene as a novel pro-apoptotic gene that will provide new insights into the regulated cellular pathways to death. false false _1161_ 0 12742 9 Not in stock false duration is short. false Hsin-Hui Ling component2174348 1 BBa_B0012 component2174346 1 BBa_B0010 component2174345 1 BBa_B0034 component2174343 1 BBa_I712004 annotation2174343 1 BBa_I712004 range2174343 1 1 654 annotation2174348 1 BBa_B0012 range2174348 1 771 811 annotation2174345 1 BBa_B0034 range2174345 1 663 674 annotation2174346 1 BBa_B0010 range2174346 1 683 762 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_I712004_sequence 1 cgatgtacgggccagatatacgcgttgacattgattattgcctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaat BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K896919_sequence 1 cgatgtacgggccagatatacgcgttgacattgattattgcctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattactagagaaagaggagaaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z