BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K896929 1 BBa_K896929 sulfate reductase 2012-04-25T11:00:00Z 2015-05-08T01:13:42Z European Molecular Biology Laboratory, Structural Biology Programme, Heidelberg, Germany bacteria that can live in the Venusian atmosphere. false false _1161_ 0 12747 9 Not in stock false 123123123123 false Tzu-hsuan Chien BBa_K896930 1 BBa_K896930 light_sulfate reductase 2012-04-25T11:00:00Z 2015-05-08T01:13:42Z AAAA light_bacteria that can live in the Venusian atmosphere. false false _1161_ 0 12747 9 Not in stock false AAAAAA false Tzu-hsuan Chien component2174278 1 BBa_I765001 component2174284 1 BBa_B0012 component2174281 1 BBa_K896929 component2174282 1 BBa_B0010 component2174280 1 BBa_B0034 annotation2174278 1 BBa_I765001 range2174278 1 1 76 annotation2174282 1 BBa_B0010 range2174282 1 837 916 annotation2174280 1 BBa_B0034 range2174280 1 85 96 annotation2174281 1 BBa_K896929 range2174281 1 103 828 annotation2174284 1 BBa_B0012 range2174284 1 925 965 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_I765001 1 pUV UV promoter 2007-10-25T11:00:00Z 2015-08-31T04:08:09Z Genomic sequence This device is regulated by UV irradiation false false _118_ 0 2266 9 In stock false None true iGEM Colombian Team 2007 annotation1955941 1 promoter range1955941 1 1 76 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K896929_sequence 1 atgaccgcgctacctgccgcatcaatcacctcttccgcgttggacgatctggacgcgctcaatgcgcagctggaaggcctgcgtgccgacgaacgcgtggcctgggcgctccagcacggcccgcaggacgcggcgctgtcgtccagcttcggcgcgcaatcggcagtgacgctgcatctgctcagccagcaacgcccggacatcccggtgatcctgatcgacaccggctacctgttcccggaaacctaccgcttcgccgatgccttgaccgaacggctcaagctcaatctcaaggtatatcgcccgctggtcagccgcgcctggatggaagcgcgccacggccgcctgtgggaacaaggcatggtcggcatcgatcagtacaacaacctgcgcaaggtcgaaccgatgcgccgcgccttggacgaactcaacgtgggcacctggttcaccggcctgcgccgcagccaatccggccgccgcgcgcagacgccaatcgtgcagaagcgcggtgagcgctacaaaatcagccccatcgccgactggaccgatcgcgacgtgtggcagtacctccaggcgcacgagctgccgtaccacccactgtgggaacaaggctacgtgtccatcggcgatttccacaccacgcgtcgctgggaacccggcatgcgcgaggaagacacgcgcttctttggcctgaagcgggagtgcggcatccacgaggatatctag BBa_B0034_sequence 1 aaagaggagaaa BBa_K896930_sequence 1 ggcaggaagaccgggcgcatgagcgtattttgtttatctaatatgcctgaaagcgcataccgctatggagggggtttactagagaaagaggagaaatactagatgaccgcgctacctgccgcatcaatcacctcttccgcgttggacgatctggacgcgctcaatgcgcagctggaaggcctgcgtgccgacgaacgcgtggcctgggcgctccagcacggcccgcaggacgcggcgctgtcgtccagcttcggcgcgcaatcggcagtgacgctgcatctgctcagccagcaacgcccggacatcccggtgatcctgatcgacaccggctacctgttcccggaaacctaccgcttcgccgatgccttgaccgaacggctcaagctcaatctcaaggtatatcgcccgctggtcagccgcgcctggatggaagcgcgccacggccgcctgtgggaacaaggcatggtcggcatcgatcagtacaacaacctgcgcaaggtcgaaccgatgcgccgcgccttggacgaactcaacgtgggcacctggttcaccggcctgcgccgcagccaatccggccgccgcgcgcagacgccaatcgtgcagaagcgcggtgagcgctacaaaatcagccccatcgccgactggaccgatcgcgacgtgtggcagtacctccaggcgcacgagctgccgtaccacccactgtgggaacaaggctacgtgtccatcggcgatttccacaccacgcgtcgctgggaacccggcatgcgcgaggaagacacgcgcttctttggcctgaagcgggagtgcggcatccacgaggatatctagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I765001_sequence 1 ggcaggaagaccgggcgcatgagcgtattttgtttatctaatatgcctgaaagcgcataccgctatggagggggtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z