BBa_K896999 1 E ΦX174; E (lysis) gene 2012-04-03T11:00:00Z 2015-05-08T01:13:42Z From where Long description false false _1161_ 0 2749 9 It's complicated false Many design considerations were taken into account when creating this sequence false Jesse Wu annotation2430261 1 signal peptide range2430261 1 1 101 annotation2430262 1 Microvirus lysis domain range2430262 1 102 225 annotation2430260 1 E range2430260 1 1 276 BBa_K896999_sequence 1 atggtacgttggactttgtgggataccctcgctttcctgctcctgttgagtttattgctgccgtcattgcttattatgttcatcccgtcaacattcaaacggcctgtctcatcatggaaggcgctgagtttacggaaaacattattaatggcgtcgagcgtccggttaaggccgctgagctgttcgcgtttaccctgcgtgtacgcgcaggaaacactgatgttcttactgacgcagaagagaacgtccgccaaaaattacgcgcagaaggagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z