BBa_K902033 1 BBa_K902033 CarAc Coding Sequence 2012-09-30T11:00:00Z 2015-05-08T01:13:43Z Pseudomonas putida plasmid pCAR1.2 The CarAc gene in Pseudomonas codes for the ferredoxin component of carbazole-1,9-dioxygenase. Together with CarAa and CarAd it forms the carbazole-1,9-dioxygenase (CARDO) enzyme which converts carbazole into 2'-aminobiphenyl-2,3-diol by cleaving one C-N bond in the original carbazole molecule. false false _1167_ 0 13454 9 In stock false None false Jeff Addison, Anya Kornilo annotation2205036 1 TAG stop codon range2205036 1 322 324 annotation2205029 1 ATG start codon range2205029 1 1 3 BBa_K902033_sequence 1 atgaaccaaatttggttgaaagtatgtgctgcatctgacatgcaacctggcacgatacgtcgcgtcaaccgcgtaggtgctgcacctctcgcagtctatcgtgttggcgatcagttctacgccactgaagatacgtgcacgcatggtattgcttcgctttcggaagggacactcgatggtgacgtgattgaatgtccctttcacggcggcgccttcaatgtttgtaccggcatgccggcatcaagtccatgtacagtgccgctaggagtgttcgaggtagaagtcaaagagggcgaagtttatgtcgccggagaaaagaagtag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z