BBa_K902085 1 BBa_K902085 R0040-mocoRibo-S7-J04500 2012-10-24T11:00:00Z 2015-05-08T01:13:44Z blahdiblah blah false false _1167_ 0 13453 9 Not in stock false blah blah false Somshukla Chaudhuri component2212878 1 BBa_K902019 component2212887 1 BBa_J04500 component2212871 1 BBa_R0040 component2212876 1 BBa_K902023 annotation2212887 1 BBa_J04500 range2212887 1 899 1118 annotation2212871 1 BBa_R0040 range2212871 1 1 54 annotation2212876 1 BBa_K902023 range2212876 1 63 191 annotation2212878 1 BBa_K902019 range2212878 1 198 890 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J04500 1 BBa_J04500 IPTG inducible promoter with RBS 2005-06-08T11:00:00Z 2015-08-31T04:08:14Z Davidson Synth-Aces Released HQ 2013 R0010.B0034 false true _16_ 0 326 16 In stock false false Kristen DeCelle component1508159 1 BBa_B0034 component1508149 1 BBa_R0010 annotation1508159 1 BBa_B0034 range1508159 1 209 220 annotation1508149 1 BBa_R0010 range1508149 1 1 200 BBa_K902023 1 BBa_K902023 Moco Riboswitch 2012-10-01T11:00:00Z 2015-05-08T01:13:43Z moco ribo moco ribo false false _1167_ 0 13453 9 In stock false moco ribo false Somshukla Chaudhuri BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961227 1 start range1961227 1 173 173 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 BBa_K902019 1 BBa_K902019 S7 micrococcal nuclease 2012-10-01T11:00:00Z 2015-05-08T01:13:43Z This part was synthesized from IDT and is native to Staphylococcus aureus S7 micrococcal nuclease false false _1167_ 0 13453 9 It's complicated false It had to be mutated false Himika Dastidar annotation2211172 1 See Design Considerations range2211172 1 312 312 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K902023_sequence 1 gggaaccactaaacacctagcctctgcacctgggtcaactgatacggtgctttggccgtgacaatgctcgtaaagattgccaccagggcgaaggaagaaatgacttcgcctcccgtatctggaaaggtg BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_J04500_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa BBa_K902019_sequence 1 atgacagagtatctcctaagcgcgggcatctgtatggccattgtttcgatcttattgatcggcatggcgatatcgaacgtatctaagggccagtacgcgaaacgcttcttctttttcgccacgagttgccttgtcttaacattagttgttgtttcttcactgtcgtccagtgcgaacgcctctcaaaccgataacggtgtaaatcgcagcgggagcgaagatcctaccgtgtattccgcgacctcaacgaaaaaacttcataaggagcccgctacgctcatcaaagccattgacggagacactgtaaagctgatgtacaaaggccaaccgatgacctttcgcttgctgctggtcgacaccccagagacgaaacatccgaaaaagggcgtcgagaaatacggcccggaagcaagtgcgtttaccaagaagatggtggaaaatgcgaacaaaattgaagtcgaatttgataaagggcagcgtaccgacaaatatggtcgtggactggcctacatttatgctgatggtaaaatggtgaatgaagcactggtgcggcagggtctggccaaagtggcttatgtgtataaaccgaataatactcacgaacagctgctgcgtaaatccgaagcacaggcaaaaaaagaaaaactgaacatttggagcgaagataacgcggatagcggtcaataataataa BBa_K902085_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagaggggaaccactaaacacctagcctctgcacctgggtcaactgatacggtgctttggccgtgacaatgctcgtaaagattgccaccagggcgaaggaagaaatgacttcgcctcccgtatctggaaaggtgtactagatgacagagtatctcctaagcgcgggcatctgtatggccattgtttcgatcttattgatcggcatggcgatatcgaacgtatctaagggccagtacgcgaaacgcttcttctttttcgccacgagttgccttgtcttaacattagttgttgtttcttcactgtcgtccagtgcgaacgcctctcaaaccgataacggtgtaaatcgcagcgggagcgaagatcctaccgtgtattccgcgacctcaacgaaaaaacttcataaggagcccgctacgctcatcaaagccattgacggagacactgtaaagctgatgtacaaaggccaaccgatgacctttcgcttgctgctggtcgacaccccagagacgaaacatccgaaaaagggcgtcgagaaatacggcccggaagcaagtgcgtttaccaagaagatggtggaaaatgcgaacaaaattgaagtcgaatttgataaagggcagcgtaccgacaaatatggtcgtggactggcctacatttatgctgatggtaaaatggtgaatgaagcactggtgcggcagggtctggccaaagtggcttatgtgtataaaccgaataatactcacgaacagctgctgcgtaaatccgaagcacaggcaaaaaaagaaaaactgaacatttggagcgaagataacgcggatagcggtcaataataataatactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z