BBa_K906007 1 BBa_K906007 pBAD promoter 2012-08-21T11:00:00Z 2015-05-08T01:13:44Z This part comes from the thiofusion vector from Invitrogen. This is a version of the pBAD promoter which is repressed by the presence of araC and glucose. It is induced by the presence of L-arabanose at about 0.02%. false false _1171_ 0 12629 9 Not in stock false This part contains a NcoI restriciton site between the promoter and the Thioredoxin in the submitted part. false Lucas B. Harrington BBa_K906007_sequence 1 aagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatacccgtttttttgggctagaaataattttgtttaactttaagaaggagatatacataccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z