BBa_K906010 1 BBa_K906010 Spacer with RBS and BsiWI and BssHII 2012-10-02T11:00:00Z 2015-05-08T01:13:44Z From Synechocystis sp. PCC6803 sequence for PsbA2 promoter http://www.ncbi.nlm.nih.gov/gene/951890 This is a part which is composed of a RBS and spacer which have been taken from Synechocystis sp. PCC 6803. The spacer is flanked by restriction sites which are not found in the sequence of Cs42. The putative RBS was identified and characterized in E. coli by the USU team from 2010. This part???s main function is to allow the modularity of the large construct Cs42s, so that each part can be used individually by teams in the future. The spacer allows for two restriction site which are located close together, to be used at the same time. It also allows for error in the predicted and actual location of the RBS. Finally, it creates the proper spacing between the RBS and the gene to be translated. false false _1171_ 0 12711 9 Not in stock false In the design of this part, the RBS was taken from Synechocystis PCC 6803 so provide the following coding region ample translation. This RBS was also shown to work in E. coli by the 2010 USU iGEM team . The restriction sites were added to allow for modularity in the composite part K906103. Spacers between the restriction sites were added to prevent a decrease in cutting efficiency near the end of the linearized DNA (A phenomena noted on New England Biolab???s page: http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cleavage_linearized_vector.asp#.UGzuRvl25go). Two restriction sites were added to allow for easy ligation of parts. Instead of requiring restriction sites with identical overhangs, the user can synthesize complementary primers with both required restriction sites. The user can then cut the primer with the same endonucleases as the DNA and, using the primer dimer as a ???linker,??? the DNA can be easily ligated together. In this way, the order of the genes may be easily interchanged so that future teams may be able to characterize the change in production caused by reordering the genes. false Caleb Ford annotation2211103 1 BsiWI range2211103 1 1 6 annotation2211114 1 PsbA2 RBS range2211114 1 16 38 annotation2211110 1 BssHII range2211110 1 10 15 annotation2211108 1 spacer range2211108 1 7 9 BBa_K906010_sequence 1 cgtacgatagcgcgcaatacataaggaattataaccaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z