BBa_K906010 1 BBa_K906010 Spacer with RBS and BsiWI and BssHII 2012-10-02T11:00:00Z 2015-05-08T01:13:44Z From Synechocystis sp. PCC6803 sequence for PsbA2 promoter http://www.ncbi.nlm.nih.gov/gene/951890 This is a part which is composed of a RBS and spacer which have been taken from Synechocystis sp. PCC 6803. The spacer is flanked by restriction sites which are not found in the sequence of Cs42. The putative RBS was identified and characterized in E. coli by the USU team from 2010. This part???s main function is to allow the modularity of the large construct Cs42s, so that each part can be used individually by teams in the future. The spacer allows for two restriction site which are located close together, to be used at the same time. It also allows for error in the predicted and actual location of the RBS. Finally, it creates the proper spacing between the RBS and the gene to be translated. false false _1171_ 0 12711 9 Not in stock false In the design of this part, the RBS was taken from Synechocystis PCC 6803 so provide the following coding region ample translation. This RBS was also shown to work in E. coli by the 2010 USU iGEM team . The restriction sites were added to allow for modularity in the composite part K906103. Spacers between the restriction sites were added to prevent a decrease in cutting efficiency near the end of the linearized DNA (A phenomena noted on New England Biolab???s page: http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cleavage_linearized_vector.asp#.UGzuRvl25go). Two restriction sites were added to allow for easy ligation of parts. Instead of requiring restriction sites with identical overhangs, the user can synthesize complementary primers with both required restriction sites. The user can then cut the primer with the same endonucleases as the DNA and, using the primer dimer as a ???linker,??? the DNA can be easily ligated together. In this way, the order of the genes may be easily interchanged so that future teams may be able to characterize the change in production caused by reordering the genes. false Caleb Ford annotation2211103 1 BsiWI range2211103 1 1 6 annotation2211114 1 PsbA2 RBS range2211114 1 16 38 annotation2211108 1 spacer range2211108 1 7 9 annotation2211110 1 BssHII range2211110 1 10 15 BBa_B1002 1 BBa_B1002 Terminator (artificial, small, %T~=85%) 2006-08-29T11:00:00Z 2015-08-31T04:07:21Z antiquity Artifical terminator, estimated %T~=85 false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 6 residues. true Haiyao Huang annotation1898412 1 B1002 range1898412 1 1 34 annotation1898414 1 Poly A tail range1898414 1 25 31 annotation1898415 1 Poly A tail range1898415 1 4 9 annotation1898413 1 stem loop range1898413 1 10 25 BBa_K906006 1 BBa_K906006 Extended psbA2 for Synechocystis 2012-08-12T11:00:00Z 2015-05-08T01:13:44Z This promoter comes from the native sequence of the region upstream of photosystem II D1 protein in Synechocystis spp. 6803. The sequences was synthsized by DNA 2.0 This is a promoter which has an extended 5' UTR relative to the previous biobrick submission of this promoter. The 5' UTR was exteneded because the previous version of this promoter has not been verified to work in Synechocystis spp. 6803, only in E. coli. Because less is known regarding the importance of false false _1171_ 0 12629 9 Not in stock false We added an additional 113 bases onto the previous biobrick version of psbA2 in order to increase the likleyhood of it functioning in Synechocystis spp. 6803. false Lucas B. Harrington annotation2179512 1 A ->T range2179512 1 200 200 BBa_K906009 1 BBa_K906009 Spacer with RBS BclI and AflII 2012-10-02T11:00:00Z 2015-05-08T01:13:44Z From Synechocystis sp. PCC6803 sequence for PsbA2 promoter This is a part which is composed of a RBS and spacer which have been taken from Synechocystis sp. PCC 6803. The spacer is flanked by restriction sites which are not found in the sequence of Cs42. The putative RBS was identified and characterized in E. coli by the USU team from 2010. This part???s main function is to allow the modularity of the large construct Cs42s, so that each part can be used individually by teams in the future. The spacer allows for two restriction site which are located close together, to be used at the same time. It also allows for error in the predicted and actual location of the RBS. Finally, it creates the proper spacing between the RBS and the gene to be translated. false false _1171_ 0 12629 9 Not in stock false In the design of this part, the RBS was taken from Synechocystis PCC 6803 so provide the following coding region ample translation. This RBS was also shown to work in E. coli by the 2010 USU iGEM team . The restriction sites were added to allow for modularity in the composite part K906103. Spacers between the restriction sites were added to prevent a decrease in cutting efficiency near the end of the linearized DNA (A phenomena noted on New England Biolab???s page: http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cleavage_linearized_vector.asp#.UGzuRvl25go). Two restriction sites were added to allow for easy ligation of parts. Instead of requiring restriction sites with identical overhangs, the user can synthesize complementary primers with both required restriction sites. The user can then cut the primer with the same endonucleases as the DNA and, using the primer dimer as a ???linker,??? the DNA can be easily ligated together. In this way, the order of the genes may be easily interchanged so that future teams may be able to characterize the change in production caused by reordering the genes. false Lucas B. Harrington annotation2211112 1 Spacer range2211112 1 7 9 annotation2211097 1 BclI range2211097 1 1 6 annotation2211104 1 AflII range2211104 1 10 15 annotation2211099 1 PsbA2 RBS range2211099 1 16 38 BBa_K906008 1 BBa_K906008 CrtZ from Arabadobsis 2012-08-22T11:00:00Z 2015-05-08T01:13:44Z The amino acid sequence that this part codes for is from the genome of Arabidopsis thaliana This part codes for the protein sequence of beta-carotene hydroxylase (CrtZ), which converts betacarotene into zeaxanthin. It has been predicted to form insoluble inclusion bodies (~90% chance) when overexpressed in E. coli according to these two online solubility models: http://mips.helmholtz-muenchen.de/prosoII/prosoII.seam and http://www.biotech.ou.edu/ false false _1171_ 0 12629 9 Not in stock false This part has been codon optimized for Synechocystis spp. 6803 false Lucas B. Harrington annotation2180613 1 Start range2180613 1 1 3 annotation2180614 1 Stop range2180614 1 931 933 BBa_K906002 1 BBa_K906002 Uracil glucosyltransferase from Crocus Sativus (UGTCs2) 2012-07-29T11:00:00Z 2015-05-08T01:13:44Z This gene was originally identified in Crocus sativus, and has been synthesized here to optimize production in Synechocystis 6803 Uracil glucosyltransferase from Crocus Sativus (UGTCs2) is a glucosyltransferase which has been shown to be highly expressed in style branch tissues of Crocus sativus. It has been implicated as the glucosyltransferase involved in the modification of the cleavage products of ZCD. It is also thought to be necessary for the production of crocin glucosides, safarnal and picrocrocin, which are the three major components of saffron. false false _1171_ 0 12629 9 In stock false This modified version of UGTCs2 has been codon optimized for the species Synechocystis 6803. It is simply the coding region of the gene without any promoter or terminator, to allow for the most flexible application of this part. false Lucas B. Harrington annotation2179292 1 Start range2179292 1 1 3 annotation2179291 1 Stop range2179291 1 1381 1383 BBa_K906000 1 BBa_K906000 Zeaxanthin 7,8-cleavage dioxygenase (ZCD) 2012-07-29T11:00:00Z 2015-05-08T01:13:44Z This enzyme was first identified in Crocus sativus, the saffron plant. The originally identified gene can be found here [http://www.ncbi.nlm.nih.gov/nuccore/AJ489276.1 AJ489276.1] This is the enzyme required to cleave zeaxanthin at the 7, 8 position to begin the enzymatic process of making crocin, picrocrocin and safranal. ZCD seems to be unique to the species Crocus sativus, and has been found to be highly expressed in the style branch tissues of this species. Also, it has been shown to produce insoluble inclusion bodies when over expressed in E. coli. As a result, the functional expression of this protein requires the use of a soluble fusion proteins, such as thioredoxin, and induction at 20degrees. false false _1171_ 0 12629 9 In stock false This modified version of ZCD has been codon optimized for the species Synechocystis 6803. false Lucas B. Harrington annotation2179290 1 Stop range2179290 1 1108 1110 annotation2179289 1 Start range2179289 1 1 3 BBa_K906103 1 BBa_K906103 Safranal and Crocin Producing Construct (Cs42s) 2012-08-22T11:00:00Z 2015-05-08T01:13:44Z This part has been designed by using the amino acid sequences from Crocus Sativus and Arabadopsis thalina. Please look at the individual parts pages for more information. This is a synthesized construct which was designed to produce safranal and crocin glycosides form zeaxanthin producing cells-the chemicals characteristic of the spice saffron. It has been designed to function in Synechocystis spp. 6803 but has not been characterized in this species. false false _1171_ 0 12629 9 It's complicated false This part has been designed to function in Synechocystis through codon optimization and promoter choice. It also contains restriction sites in between the ORFs as seen in the diagram on the main page. false Lucas B. Harrington component2211240 1 BBa_B1002 component2211235 1 BBa_K906011 component2211231 1 BBa_K906008 component2211215 1 BBa_K906000 component2211220 1 BBa_K906009 component2211223 1 BBa_K906002 component2211228 1 BBa_K906010 component2211212 1 BBa_K906006 annotation2211235 1 BBa_K906011 range2211235 1 3703 3717 annotation2211228 1 BBa_K906010 range2211228 1 2732 2769 annotation2211220 1 BBa_K906009 range2211220 1 1311 1348 annotation2211231 1 BBa_K906008 range2211231 1 2770 3702 annotation2211223 1 BBa_K906002 range2211223 1 1349 2731 annotation2211240 1 BBa_B1002 range2211240 1 3718 3751 annotation2211212 1 BBa_K906006 range2211212 1 1 200 annotation2211215 1 BBa_K906000 range2211215 1 201 1310 BBa_K906011 1 BBa_K906011 Spacer with MluI and SacII 2012-10-02T11:00:00Z 2015-05-08T01:13:44Z From Synechocystis sp. PCC6803 sequence for PsbA2 promoter http://www.ncbi.nlm.nih.gov/gene/951890 This is a part which is composed of a RBS and spacer which have been taken from Synechocystis sp. PCC 6803. The spacer is flanked by restriction sites which are not found in the sequence of Cs42. The putative RBS was identified and characterized in E. coli by the USU team from 2010. This part???s main function is to allow the modularity of the large construct Cs42s, so that each part can be used individually by teams in the future. The spacer allows for two restriction site which are located close together, to be used at the same time. It also allows for error in the predicted and actual location of the RBS. Finally, it creates the proper spacing between the RBS and the gene to be translated. false false _1171_ 0 12624 9 Not in stock false In the design of this part, the RBS was taken from Synechocystis PCC 6803 so provide the following coding region ample translation. This RBS was also shown to work in E. coli by the 2010 USU iGEM team . The restriction sites were added to allow for modularity in the composite part K906103. Spacers between the restriction sites were added to prevent a decrease in cutting efficiency near the end of the linearized DNA (A phenomena noted on New England Biolab???s page: http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cleavage_linearized_vector.asp#.UGzuRvl25go). Two restriction sites were added to allow for easy ligation of parts. Instead of requiring restriction sites with identical overhangs, the user can synthesize complementary primers with both required restriction sites. The user can then cut the primer with the same endonucleases as the DNA and, using the primer dimer as a ???linker,??? the DNA can be easily ligated together. In this way, the order of the genes may be easily interchanged so that future teams may be able to characterize the change in production caused by reordering the genes. false Andrew Ng annotation2211124 1 Spacer range2211124 1 7 9 annotation2211125 1 SacII range2211125 1 10 15 annotation2211123 1 MluI range2211123 1 1 6 BBa_K906011_sequence 1 acgcgtataccgcgg BBa_K906000_sequence 1 atgcaagtagaccccacaaaaggaatcggattagccaacacctctcttcagtttagtaatggccgcctgcatgccttgtgcgaatatgatctaccttacgtggtacggctgagtccggaagatggcgatatcagtaccgtgggtcgtatcgaaaacaatgtgtctaccaaaagtactaccgcacatcctaaaactgaccctgtgacgggagaaacctttagcttttcctacgggcccattcaaccctacgttacgtatagcagatatgattgcgacggcaaaaagagtggccccgatgttccgatattctcctttaaagaaccctctttcgtacatgactttgcaattactgagcactatgccgtgtttcctgatattcagattgtcatgaaaccagctgagattgttcggggtcggagaatgatcgggccagatttggaaaaagtcccccgtctggggctattaccgcgttatgccacctcagacagcgaaatgcgctggtttgacgtacccggttttaacatggtacacgtagtcaatgcgtgggaagaagagggaggcgaagtggtggtcattgttgccccgaatgtttcacccattgagaatgccattgatcgctttgatttgttacatgtgtccgtggagatggcgcggattgaactcaaatccggttccgtgagtcgcaccctactgtctgcggaaaacttagattttggagttattcatcggggttattctggtcgaaaaagcaggtacgcttacttgggcgtgggggatccaatgcccaaaattcgcggtgttgtgaaagtggacttcgaactggccggtcgaggggagtgtgttgtggctcggcgcgagtttggcgtcggctgtttcggaggggaacctttctttgtacccgcttccagcaagaagtcgggtggcgaagaagatgatggctatgttgtgagttacctccacgatgaaggcaagggtgaaagttcctttgtcgttatggacgcccgttcgccagaacttgaaatcttggctgaggtggtgttacccaggcgtgtcccctatgggtttcatgggttatttgtgacagaagcggaactcttgtcccaacaataa BBa_K906010_sequence 1 cgtacgatagcgcgcaatacataaggaattataaccaa BBa_B1002_sequence 1 cgcaaaaaaccccgcttcggcggggttttttcgc BBa_K906008_sequence 1 atggcagcaggattatcgaccgcagttacgttcaaacccctacatcggagttttagcagctcttccactgactttagattgcgtctgcccaaaagtttatccggctttagccccagtctccggttcaaacgattctccgtttgttacgtggtcgaagaacgtcggcaaaattccccgattgagaacgacgaacgcccagaatcaaccagttccaccaatgccatcgatgcggagtatttagctcttcggctcgctgagaagttggagcgcaaaaagagcgaaaggtccacctatctcattgccgcgatgttgtcaagttttgggattacgagcatggccgtgatggccgtctactatcgcttttcgtggcaaatggaaggtggggaaattagtatgttagaaatgttcggcacttttgctcttagtgtcggtgccgccgtgggcatggagttttgggcacgttgggcccatcgggccctgtggcacgcttctttgtggaacatgcatgaatcgcaccataaaccccgcgaagggccgtttgaactaaatgacgtatttgcgatagtgaatgcgggaccagctattggtttgttatcttatggcttctttaacaaaggcctggttcctgggctgtgctttggagccggattgggcattacagtgttcggtattgcctacatgtttgtgcacgatgggttagttcataaacgatttcccgtggggcccattgctgatgtgccttatttgaggaaagtagctgcggcccatcagcttcaccataccgataagtttaatggcgttccttatggcctatttctgggacccaaagaattagaagaggtaggtggtaatgaagaactagataaagaaatctcacgccgtatcaagtcttacaaaaaggcctccggtagcgggtcctcttccagtagttaa BBa_K906103_sequence 1 ctcttctcaacccccaaaacgccctctgtttacccatggaaaaaacgacaattacaagaaagtaaaacttatgtcatctataagcttcgtgtatattaacttcctgttacaaagctttacaaaactctcattaatcctttagactaagtttagtcagttccaatctgaacatcgacaaatacataaggaattataaccatatgcaagtagaccccacaaaaggaatcggattagccaacacctctcttcagtttagtaatggccgcctgcatgccttgtgcgaatatgatctaccttacgtggtacggctgagtccggaagatggcgatatcagtaccgtgggtcgtatcgaaaacaatgtgtctaccaaaagtactaccgcacatcctaaaactgaccctgtgacgggagaaacctttagcttttcctacgggcccattcaaccctacgttacgtatagcagatatgattgcgacggcaaaaagagtggccccgatgttccgatattctcctttaaagaaccctctttcgtacatgactttgcaattactgagcactatgccgtgtttcctgatattcagattgtcatgaaaccagctgagattgttcggggtcggagaatgatcgggccagatttggaaaaagtcccccgtctggggctattaccgcgttatgccacctcagacagcgaaatgcgctggtttgacgtacccggttttaacatggtacacgtagtcaatgcgtgggaagaagagggaggcgaagtggtggtcattgttgccccgaatgtttcacccattgagaatgccattgatcgctttgatttgttacatgtgtccgtggagatggcgcggattgaactcaaatccggttccgtgagtcgcaccctactgtctgcggaaaacttagattttggagttattcatcggggttattctggtcgaaaaagcaggtacgcttacttgggcgtgggggatccaatgcccaaaattcgcggtgttgtgaaagtggacttcgaactggccggtcgaggggagtgtgttgtggctcggcgcgagtttggcgtcggctgtttcggaggggaacctttctttgtacccgcttccagcaagaagtcgggtggcgaagaagatgatggctatgttgtgagttacctccacgatgaaggcaagggtgaaagttcctttgtcgttatggacgcccgttcgccagaacttgaaatcttggctgaggtggtgttacccaggcgtgtcccctatgggtttcatgggttatttgtgacagaagcggaactcttgtcccaacaataatgatcaatacttaagaatacataaggaattataaccaaatgctgaacggaaacaaatgccacatcttactattgccatgtcccgctcaaggtcatattaatccaattttgcaatttgggaagcgtctggcttcccataacctgttaacgaccttagtgaatacccgatttttgagcaatagtacaaaatccgaaccagggcctgtgaatatccaatgtatttcagacggatttgacccgggaggcatgaatgcggctcccagtcggcgagcgtacttcgataggccgcagtctcggtccggccagaaacatgtgggcttgattgaatccctacgtagcagaggtcgtcccggtgcctgctttgggcttcggccggtgccattgtgggcaatgaatgtagccgaacgctctggactccgctcggtagcgtttttcactcaaccctgtgccgtcgacaccatttaccggcacgtctgggaagggcggattaaagtgcctgtcgctgagcccgtccggctgccgggcttgccccctttggaaccgtctgatctaccctgtgttcgcaacggttttggacgtgtcgtgaatcctgatttgttgcccttgcgcgtaaaccagcataagaacttggataaagccgatatgatgggacgcaacagcatttatgaattagaagccgatctgttagatgggagtaggttacccctgccggtgaaatccattggccccaccgttcctagtacctacctagataatcgtatacctagcgattcccattacggttttaacctctatacacccgacactaccccctatctcgattggttagattccaaagcacctaatagtgtgatttatgttagttttggttccttatcctcactgagtcccgatcaaactaatgaaatcgccagcggccttattgctaccaataagagctttatctgggtagtgcgcacgtccgagttagccaagttacccgccaatttcacccaagagaatgcaagtcgtggcctcgttgtgacctggtgtgaccaactcgatcttcttgcccatgtggccacgggctgttttgttactcactgtggttggaactcgacaatggaaggggttgctctgggggtgcccatggttggggttccccaatggagcgatcagccaatgaatgccaaatatgttgaagatgtgtggaaagtaggcgtgcgggcgaaaacttatggtaaagactttgtgaggggcgaagagtttaaacgatgcgttgaggaagtaatggacggggaacgctcaggcaagatcagagaaaatgctgcgcggtggtgcaaactagccaaagactctgtgtctgaaggtggtagtagtgacaagtgtattaaggagttcattcaccagtgttgcaatgattctaaaatctccctcgtctaacgtacgatagcgcgcaatacataaggaattataaccaaatggcagcaggattatcgaccgcagttacgttcaaacccctacatcggagttttagcagctcttccactgactttagattgcgtctgcccaaaagtttatccggctttagccccagtctccggttcaaacgattctccgtttgttacgtggtcgaagaacgtcggcaaaattccccgattgagaacgacgaacgcccagaatcaaccagttccaccaatgccatcgatgcggagtatttagctcttcggctcgctgagaagttggagcgcaaaaagagcgaaaggtccacctatctcattgccgcgatgttgtcaagttttgggattacgagcatggccgtgatggccgtctactatcgcttttcgtggcaaatggaaggtggggaaattagtatgttagaaatgttcggcacttttgctcttagtgtcggtgccgccgtgggcatggagttttgggcacgttgggcccatcgggccctgtggcacgcttctttgtggaacatgcatgaatcgcaccataaaccccgcgaagggccgtttgaactaaatgacgtatttgcgatagtgaatgcgggaccagctattggtttgttatcttatggcttctttaacaaaggcctggttcctgggctgtgctttggagccggattgggcattacagtgttcggtattgcctacatgtttgtgcacgatgggttagttcataaacgatttcccgtggggcccattgctgatgtgccttatttgaggaaagtagctgcggcccatcagcttcaccataccgataagtttaatggcgttccttatggcctatttctgggacccaaagaattagaagaggtaggtggtaatgaagaactagataaagaaatctcacgccgtatcaagtcttacaaaaaggcctccggtagcgggtcctcttccagtagttaaacgcgtataccgcggcgcaaaaaaccccgcttcggcggggttttttcgc BBa_K906009_sequence 1 tgatcaatacttaagaatacataaggaattataaccaa BBa_K906006_sequence 1 ctcttctcaacccccaaaacgccctctgtttacccatggaaaaaacgacaattacaagaaagtaaaacttatgtcatctataagcttcgtgtatattaacttcctgttacaaagctttacaaaactctcattaatcctttagactaagtttagtcagttccaatctgaacatcgacaaatacataaggaattataaccat BBa_K906002_sequence 1 atgctgaacggaaacaaatgccacatcttactattgccatgtcccgctcaaggtcatattaatccaattttgcaatttgggaagcgtctggcttcccataacctgttaacgaccttagtgaatacccgatttttgagcaatagtacaaaatccgaaccagggcctgtgaatatccaatgtatttcagacggatttgacccgggaggcatgaatgcggctcccagtcggcgagcgtacttcgataggccgcagtctcggtccggccagaaacatgtgggcttgattgaatccctacgtagcagaggtcgtcccggtgcctgctttgggcttcggccggtgccattgtgggcaatgaatgtagccgaacgctctggactccgctcggtagcgtttttcactcaaccctgtgccgtcgacaccatttaccggcacgtctgggaagggcggattaaagtgcctgtcgctgagcccgtccggctgccgggcttgccccctttggaaccgtctgatctaccctgtgttcgcaacggttttggacgtgtcgtgaatcctgatttgttgcccttgcgcgtaaaccagcataagaacttggataaagccgatatgatgggacgcaacagcatttatgaattagaagccgatctgttagatgggagtaggttacccctgccggtgaaatccattggccccaccgttcctagtacctacctagataatcgtatacctagcgattcccattacggttttaacctctatacacccgacactaccccctatctcgattggttagattccaaagcacctaatagtgtgatttatgttagttttggttccttatcctcactgagtcccgatcaaactaatgaaatcgccagcggccttattgctaccaataagagctttatctgggtagtgcgcacgtccgagttagccaagttacccgccaatttcacccaagagaatgcaagtcgtggcctcgttgtgacctggtgtgaccaactcgatcttcttgcccatgtggccacgggctgttttgttactcactgtggttggaactcgacaatggaaggggttgctctgggggtgcccatggttggggttccccaatggagcgatcagccaatgaatgccaaatatgttgaagatgtgtggaaagtaggcgtgcgggcgaaaacttatggtaaagactttgtgaggggcgaagagtttaaacgatgcgttgaggaagtaatggacggggaacgctcaggcaagatcagagaaaatgctgcgcggtggtgcaaactagccaaagactctgtgtctgaaggtggtagtagtgacaagtgtattaaggagttcattcaccagtgttgcaatgattctaaaatctccctcgtctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z