BBa_K907001 1 Bxb1_Xis Mycobacterium Phage Bxb1 gp47, DNA excisionase 2012-09-19T11:00:00Z 2015-05-08T01:13:44Z This part is derived by Mycobacterium phage Bxb1. And synthesized by Bioneer. http://www.ncbi.nlm.nih.gov/protein/NP_075302.1 This part is the protein coding sequence which encodes DNA integrase of Mycobacterium phage Bxb1. The Bxb1 integrase is a DNA recombinase, more precisely a member of serine integrase family. It recognizes specific sequences, called attB and attP, and then integrate, invert, or excise depend on orientations of recognition sequences. We used this integrase to invert specific sequence contained in plasmid. This protein is well expressed in E.coli(strain MG1655). When it inverts DNA, the attB and attP sequences are changed into attL and attR, as common DNA recombinases do. Another protein called Bxb1 excisionase interacts with integrase and that complex flips back inverted DNA into original sequence regenerating attB and attP sequences. false false _1172_ 0 12628 9 Not in stock false Internal restriction endonuclease site is changed(two PstI sites, one XbaI sites) without changing amino acid sequence. false Dong-hui Choe, Soo-in Lee annotation2187532 1 Bacteriophage Bxb1 excisionase CDS range2187532 1 1 768 BBa_K907001_sequence 1 atgactcagcgtatcgtctttctacccgatactcagttgcctttcgaggcgcgcaaagagatgcaagcggtcatccgcttcatcggggatgtccagccgtacggcgtggtacatatcggtgacgtcctagacctgccgcagccctcgcgctggaaccggggaaccaagggcgagttcgagggctcggtgtaccgcgacgcggactacgccaagaagaacctgatggagccgctgcgcaaggtctacgacggctggatcgggatgcacgagggcaaccacgatctgcgagcccgcgagtacctggccaagaacgcaccggccctggagggtacgcacgctttcgacatcgacgtgctgctcgacttcgacgggttcggtgtggagctgctgcctgacttctacgacatcgctccgggctggatctccactcacgggcacatgggcaagatgacgctatcccagatcgccggatcgacagcgctcaacggtgccaagaagttcggcaagtccgtggtctgcggccacacgcaccggcaggctgtcgtctcgcactcgttcgggtacggcggctcggtgcgcaagaccgtcaccggcatggaagtcgggcacctgatggacatgaagaaggccaactatctaaagggcggagccgggaactggcagatgggcttcgggatgctcacggtcgacggcaagcatgtcaaggctgagatcgtcccgatcctgggaggcaagttcaccgttgacggccaggtctgggaagtctag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z