BBa_K907002 1 FlipFlop Binary signal generator, RBS(reverse) - attB - Promoter - attP - RBS 2012-09-19T11:00:00Z 2015-05-08T01:13:44Z Promoter and RBS are derived from BBa_J23119 and BBa_B0034, respectively. Whole construct was de novo synthesized by Bioneer. Dual phase protein generator promoter reversed, RBS(reverse) - attB - Promoter(reverse) - attP - RBS This part is composed of 3 elements. 1. RBS: BBa_B0034, upsteam one is reversed 2. Promoter: BBa_J23119, Bacterial constitutive promoter 3. att site: Recognition site for Mycobacteriophage Bxb1 integrase/excisionase We designed this part to generate two different proteins one at a time. At the first state, this device promotes transcription and translation of downstream gene because its promoter orientation. When Mycobacteriophage Bxb1 integrase recognizes and inverts sequence flanking with attB and attP sequence, promoter orientation reversed. Then this device promotes transcription and translation of upstream gene(must be reversed at the construction step). This device is tested by GFP and mRFP attached construct. See BBa_K090700N and BBa_K090700N false false _1172_ 0 12628 9 It's complicated false No false Dong-hui Choe, Soo-in Lee annotation2189782 1 attB(Bxb1 Int) range2189782 1 19 68 annotation2189784 1 attP(Bxb1 Int) range2189784 1 104 156 annotation2188632 1 BBa_B0034, reverse range2188632 1 1 12 annotation2189785 1 BBa_J23119 range2189785 1 69 103 annotation2188633 1 BBa_B0034 range2188633 1 163 174 BBa_K907002_sequence 1 tttctcctctttaagctttcggccggcttgtcgacgacggcggtctccgtcgtcaggatcatccgggcttgacagctagctcagtcctaggtataatgctagcgggtttgtaccgtacaccactgagaccgcggtggttgaccagacaaaccacgactcgagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z