BBa_K907003 1 FlipFlop Binary signal generator, promoter reversed, RBS(reverse) - attB - Promoter(reverse) - attP - RBS 2012-09-19T11:00:00Z 2015-05-08T01:13:44Z Promoter and RBS are derived from BBa_J23119 and BBa_B0034, respectively. Whole construct was de novo synthesized by Bioneer. Dual phase protein generator promoter reversed, RBS(reverse) - attB - Promoter(reverse) - attP - RBS This part is composed of 3 elements. 1. RBS: BBa_B0034, upsteam one is reversed 2. Promoter: BBa_J23119, Bacterial constitutive promoter 3. att site: Recognition site for Mycobacteriophage Bxb1 integrase/excisionase We designed this part to generate two different proteins one at a time. At the first state, this device promotes the transcription and translation of downstream gene because of its promoter orientation. When Mycobacteriophage Bxb1 integrase recognizes and inverts the sequence flanking with attB and attP sequence, promoter orientation reversed. Then this device promotes the transcription and translation of upstream gene(must be reversed at the construction step). This device is tested by GFP and mRFP attached construct. See BBa_K090700N and BBa_K090700N false false _1172_ 0 12628 9 It's complicated false No false Dong-hui Choe, Soo-in Lee annotation2189962 1 attB(Bxb1 Int) range2189962 1 19 68 annotation2189960 1 BBa_B0034(reverse) range2189960 1 1 12 annotation2189961 1 BBa_B0034 range2189961 1 163 174 annotation2190007 1 BBa_J23119(reverse) range2190007 1 69 103 annotation2190006 1 attP(Bxb1 Int) range2190006 1 104 156 BBa_K907003_sequence 1 tttctcctctttaagctttcggccggcttgtcgacgacggcggtctccgtcgtcaggatcatccgggcgctagcattatacctaggactgagctagctgtcaagggtttgtaccgtacaccactgagaccgcggtggttgaccagacaaaccacgactcgagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z