BBa_K908000 1 BBa_K908000 Microcin B17, Gene A 2012-09-18T11:00:00Z 2015-05-08T01:13:44Z Plasmid pCID909. Open redading frame of the gene A of microcin B17. true false _1173_ 0 13962 9 Discontinued false No design considerations false Wacquier Benjamin annotation2187176 1 protein range2187176 1 1 210 BBa_K908000_sequence 1 atggaattaaaagcgagtgaatttggtgtagttttgtccgttgatgctcttaaattatcacgccagtctccattaggtgttggcattggtggtggtggcggcggcggcggcggcggtagctgcggtggtcaaggtggcggttgtggtggttgcagcaacggttgtagtggtggaaacggtggcagcggcggaagtggttcacatatctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z