BBa_K908009 1 BBa_K908009 Microcin C7, Gene A 2012-09-18T11:00:00Z 2015-05-08T01:13:44Z Plasmid pp70 Open reading frame of the gene A of microcin C7. true false _1173_ 0 13962 9 Discontinued false No design considerations false Wacquier Benjamin BBa_K908009_sequence 1 atgcgtactggtaatgcaaactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z