BBa_K908015 1 BBa_K908015 Microcin B17, Gene A flanked by rbs and Attc sequence 2012-09-18T11:00:00Z 2015-05-08T01:13:44Z Come from BBa_K9008000 and BBa_J99001 Microcin B17, Gene A flanked by Attc sequence false false _1173_ 0 13962 9 In stock false No design considerations false Wacquier Benjamin annotation2201338 1 BBa_B0030 range2201338 1 1 15 annotation2201344 1 R range2201344 1 281 285 annotation2201339 1 RBS-1\Strong range2201339 1 1 15 annotation2201340 1 RBS range2201340 1 8 12 annotation2201341 1 MccBA range2201341 1 16 225 annotation2201343 1 R range2201343 1 230 234 annotation2201345 1 recombination point range2201345 1 283 284 annotation2201342 1 BBa_J99001 range2201342 1 226 289 BBa_K908015_sequence 1 attaaagaggagaaaatggaattaaaagcgagtgaatttggtgtagttttgtccgttgatgctcttaaattatcacgccagtctccattaggtgttggcattggtggtggtggcggcggcggcggcggcggtagctgcggtggtcaaggtggcggttgtggtggttgcagcaacggttgtagtggtggaaacggtggcagcggcggaagtggttcacatatctgaggttataacaattcattcaagccgacgccgcttcgcggcgcggcttaattcaagcgttataacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z