BBa_K909007 1 BBa_K909007 TetR DNA binding domain containing BamHI site for protein fusions 2012-09-22T11:00:00Z 2015-05-08T01:13:45Z E. coli Tn10 transposon Released HQ 2013 Truncated version of tetracycline repressor TetR, consisting of 1 ??? 127 amino acids, containing DNA binding domain. The rest of the structure, 8-10 helixes responsible for tetR dimerization, were removed in order to keep tetR-DBD in monomer form and prevent from efficient DNA binding and transcription repression. In addition, we introduced BamHI site at C terminus for an easy in tetR-DBD frame fusions with other proteins. Thus, it can be used in two hybrid systems for both, homo and hetero dimerizations, also one can use these fusions to turn protein-protein interaction into the repression of transcription. false false _1174_ 0 14094 9 In stock true Deletion of 8-10 helixes might lower the stability of protein, also TetR-DBD is no longer responsive to anhydrotetracycline false Gintautas Vainorius annotation2194604 1 BamHI restriction site range2194604 1 382 387 BBa_K909007_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactaggatcctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z