BBa_K909010 1 BBa_K909010 YcgZ promoter with multiple BluR (YcgE) operator sites 2012-09-22T11:00:00Z 2015-05-08T01:13:45Z K238013 as template for PCR Tschowri et al., 2009; Genes Dev 23: 522??? 534 Tschowri et al., 2012; Mol. Microbiol: 1-14; doi:10.1111/j.1365-2958.2012.08147.x Escherichia coli senses blue light via the BLUF-EAL protein BluF (YcgF). The degenerate EAL domain of BluF does not have cyclic-di-GMP phosphodiesterase activity, but BluF directly antagonizes the MerR-like repressor BluR (YcgE), which leads to expression of the ycgZ-ymgABC operon false false _1174_ 0 14088 9 It's complicated true Based on the paper (Tschowri et al., 2012; Mol. Microbiol: 1-14) published in July 2012 in that they showed the binding site of BluR to the YcgZ promoter, more BluR binding sites were introduced to the YcgZ promoter to decrease leakiness of the promoter and therefore increase the repression by BluR. false Deborah Huber annotation2194161 1 BluR operator site range2194161 1 26 31 annotation2194166 1 BluR operator site range2194166 1 69 73 annotation2194165 1 BluR operator site range2194165 1 55 60 annotation2194163 1 -35 range2194163 1 28 33 annotation2194162 1 BluR operator site range2194162 1 40 44 annotation2194164 1 -10 range2194164 1 52 57 BBa_K909010_sequence 1 attgcaaaaaattaatttatcattctgtacacatatttcgtacaagtttgctattgtacacatatttcgtacat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z