BBa_K909013 1 BBa_K909013 PR promoter with multiple operator sites: cI OR1, cI OR2 and TetO1 2012-09-22T11:00:00Z 2015-05-08T01:13:45Z fwfe The promoter is derived from the PR (lambda phage) promoter. The -35 and -10 regions are conserved while the cI operator sites and sequence between the -35 and -10 regions were replaced by the operators cI OR1, cI OR2 and TetO1. false false _1174_ 0 14088 9 In stock false feefewf false Deborah Huber annotation2194202 1 cI OR1 range2194202 1 30 46 annotation2194203 1 PR -10 range2194203 1 43 48 annotation2194204 1 TetO1 range2194204 1 51 70 annotation2194200 1 cI OR2 range2194200 1 6 22 annotation2194201 1 PR -35 range2194201 1 20 25 BBa_K909013_sequence 1 gcggctaacaccgtgcgtgttgactattttacctctggcggtgataattaatccctatcagtgatagagatcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z