BBa_K909016 1 BBa_K909016 PR promoter with two operator sites: cI OR1, cI OR2 and and LacI O1/O2 2012-09-23T11:00:00Z 2015-05-08T01:13:45Z de-novo design The promoter is derived from the PR (lambda phage) promoter. The -35 and -10 regions as well as the cI operator sites are maintained while the sequence downstream of the -10 region is replaced by the operator LacO1. false false _1174_ 0 14095 9 It's complicated false This double negative hybrid promoter is only active, if cI AND lacI are absent. It functions as a biological NOR gate. false Sandro Kundert annotation2195899 1 cI OR1 range2195899 1 26 48 annotation2195898 1 cI OR2 range2195898 1 6 25 annotation2195901 1 lac O1/O2 range2195901 1 52 82 annotation2195893 1 PR -35 range2195893 1 20 25 annotation2195896 1 PR -10 range2195896 1 43 48 BBa_K909016_sequence 1 gcggctaacaccgtgcgtgttgactattttacctctggcggtgataatttgtggaattgtgagcggataacatttcacacagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z