BBa_K911001 1 BBa_K911001 Magnesium sensitive riboswitch 2012-09-06T11:00:00Z 2015-05-08T01:13:45Z Bacillus Subtilis Genome Riboswitch that acts as a regulatory element, truncating transcripts when magnesium is not bound to the RNA. Four Mg2+ binding sites exist, giving this part significantly switch-like behavior. Binding of these sites by Mg2+ results in compaction of the regulatory region of the riboswitch, which in its unbound state acts as an anti-terminator. Loss of this anti-terminator activity results in the activity of a downstream terminator (included in this sequence) which terminates transcription of the gene. May also be affected by other divalent ions, such as manganese. false false _1176_ 0 12694 9 It's complicated true Original paper mentioned 8 codon substitution of the downstream LacZ reporter gene with the first 8 codons of the MgtE gene (which is the native gene which this riboswitch controls). Our construct used LacI as the downstream regulated sequence, which requires its N-terminal domain to bind to DNA. Sequences both with and without this substitution have been submitted. This copy does not contain the substitution. false Oliver Meacock annotation2182005 1 Terminator range2182005 1 284 299 annotation2182006 1 M-box range2182006 1 95 250 BBa_K911001_sequence 1 tgttccgtaattgtgatgtaagcgcatttattacttttttgagttgacatagcttgtttttttctgtaatctcagtgtgtcaattcaattaggaacttcgttaggtgaggctcctgtatggagatacgctgctgcccaaaaatgtccaaagacgccaatgggtcaacagaaatcatcgacataaggtgatttttaatgcagctggatgcttgtcctatgccatacagtgctaaagctctacgattgaaggcgcccgcacgctttttttgccgtgcttctttcaccttcaatcccgaaggctttttttatgcctttaaaacgaaaccaatcaaaggaggtgcggagtatggattctccccattcgagtcaatctgaagaagtacccatatactatgacagcaagacaattgattacacgatgaggagacgaactgccgcaccttctggcgaggccggcacgtctccgtagaggaggtacgagtcccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z