BBa_K911002 1 BBa_K911002 Magnesium sensitive riboswitch (8 codon substitution) 2012-09-11T11:00:00Z 2015-05-08T01:13:45Z Bacillus Genome Riboswitch that acts as a regulatory element, truncating transcripts when magnesium is not bound to the RNA. Four Mg2+ binding sites exist, giving this part significantly switch-like behavior. Binding of these sites by Mg2+ results in compaction of the regulatory region of the riboswitch, which in its unbound state acts as an anti-terminator. Loss of this anti-terminator activity results in the activity of a downstream terminator (included in this sequence) which terminates transcription of the gene. May also be affected by other divalent ions, such as manganese. false false _1176_ 0 12694 9 It's complicated false Original paper mentioned 8 codon substitution of the downstream LacZ reporter gene with the first 8 codons of the MgtE gene (which is the native gene which this riboswitch controls). Our construct used LacI as the downstream regulated sequence, which requires its N-terminal domain to bind to DNA. Sequences both with and without this substitution have been submitted. This contains the substitution. Please note that to use this version effectively, an assembly method that does not leave scars (such as Gibson assembly) will be required. false Oliver Meacock annotation2182731 1 Terminator range2182731 1 284 299 annotation2182729 1 8 codon substitution. range2182729 1 487 510 annotation2182730 1 M-box range2182730 1 95 250 BBa_K911002_sequence 1 tgttccgtaattgtgatgtaagcgcatttattacttttttgagttgacatagcttgtttttttctgtaatctcagtgtgtcaattcaattaggaacttcgttaggtgaggctcctgtatggagatacgctgctgcccaaaaatgtccaaagacgccaatgggtcaacagaaatcatcgacataaggtgatttttaatgcagctggatgcttgtcctatgccatacagtgctaaagctctacgattgaaggcgcccgcacgctttttttgccgtgcttctttcaccttcaatcccgaaggctttttttatgcctttaaaacgaaaccaatcaaaggaggtgcggagtatggattctccccattcgagtcaatctgaagaagtacccatatactatgacagcaagacaattgattacacgatgaggagacgaactgccgcaccttctggcgaggccggcacgtctccgtagaggaggtacgagtcccgatggttcaaaacatgacctatgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z