BBa_K911008 1 BBa_K911008 Fast Germination (B.subtilis) 2012-09-23T11:00:00Z 2015-05-08T01:13:45Z spoVAA and PsspB from B.subtilis Genome. This part upregulates an operon responsible for germination rate. Bacillus subtilis spores germinate in response L-Alanine. Up-regulation of the spoVA operon increases germination rate in response to L-Alanine. The promoter for the B.subtilis sspB gene (PsspB) is more active than the endogenous spoVA promoter. It is also active during germination. Expression of the spoVA operon under PsspB increases the germination rate. This construct consists mainly of the sspB promoter followed by the first 354bp of the spoVA operon (first 354bp of the spoVAA gene). Since B.subtilis exhibits accurate and efficient homologous recombination, a single cross-over event between the spoVAA region in the BioBrick and the endogenous spoVAA sequence inserts the sspB promoter upstream of the spoVA operon. false false _1176_ 0 13048 9 It's complicated true The design of this BioBrick is based on a plasmid (pPS3393)from Wang et al. (2011) Wang, G., Yi, X., Li, Y.-Q., Setlow, P. Germination of individual Bacillus subtilis spores with alterations in the GerD and SpoVA proteins, which are important in spore germination(2011) J. Bacteriology, 193 (9), pp. 2301-2311. false Stuart Bell annotation2196275 1 SPOVAA insertion sequence range2196275 1 199 552 annotation2196274 1 PsspB (Highly active germination specific promoter) range2196274 1 20 104 BBa_K911008_sequence 1 gccaagctttttttatttctcaagatttaccacacaattctccgcatgattttccggccattttaacataatacgtagtaacaagccggcaaagcattgggttacgccgaggcggcagtgacacccgagaagggttcacagattggtgcaactccagttaacccaaccatactaaataaaaaggagattttacatatgatggaacgacgaatatttatccggcttcgccaccgagtgctggcacatccaggggatattattaccgttggagatgccgcgcaaatagaagggcagcttcagctgaaaaagaaactttcggctatgccgctttatcaggtgagcgaaaaagataaaaatatcgtaattctggatatcatacaagtcctcagagccattcatttacaagacccgacaattgatgttcaaaccgtaggcggagcagaaaccattgttgaaattcagtatcgaaagcgaaatttatcaacggttctatttatcggtgtctggctgcttctgtttattggatcgtgtcttgccatcatgaactttcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z