BBa_K914000 1 BBa_K914000 pLac-supD-T 2012-09-17T11:00:00Z 2015-05-08T01:13:45Z This part is made from the 3 Biobricks previously describe : R0011 - K228001 - B1006 This part is composed of a tRNA amber suppressor, supD (K228001), which is under the control of pLac (R0011). A terminator is added (B1006, but the sequence is not the exact one, it's not a problem here). This part is used to allow the expression of gene that have one or many amber codon instead of a Serine. Adding IPTG could be usefull when there are to many amber codon in the cell. false false _1179_ 0 13470 9 It's complicated true The promoter is the last part added, meaning that from the previous intermediate (soon available), we will be able to change the promoter easily. false Jean Cury annotation2189150 1 -35 range2189150 1 20 25 annotation2189155 1 modified thr terminator range2189155 1 217 238 annotation2189152 1 -10 range2189152 1 43 48 annotation2189153 1 BBa_K228001 range2189153 1 64 199 annotation2189151 1 lac O1 range2189151 1 26 42 annotation2189148 1 BBa_R0011 range2189148 1 1 54 annotation2189154 1 BBa_B1006 modified range2189154 1 208 241 annotation2189149 1 lac O1 range2189149 1 3 19 BBa_K914000_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagcaattcggagagatgccggagcggctgaacggaccggtctctaaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactacagatccttagcgaaagctaaggattttttttaagcttactagagcgccgcaaaccccgcttcggcggggtttcgccgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z