BBa_K914017 1 BBa_K914017 YiaG promoter 2012-10-24T11:00:00Z 2015-05-08T01:13:46Z genomic DNA of MG1655 Stationary phase promoter false false _1179_ 0 13620 9 It's complicated false 90bp usptream of the +1 site false Ernest Mordret BBa_K914017_sequence 1 cacgctaaatgacaggctgaatcgaatcatagccagagcatgccctgacttcaccccgctgtgtctgcttttcccgactattcttaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z