BBa_K914018 1 BBa_K914018 P1003** Kan resistant gene with 2 Amber Codon 2012-10-24T11:00:00Z 2015-05-08T01:13:46Z This part is made from the BBa_K914009 part from which I add a second mutation with the QuickChange Site-directed mutagenesis kit, Agilent. The amber mutations avoid the expression of the P1003 gene even at usual concentration that prevent the expression of kanamycin resistance, although one mutation (BBa_K914009) permits some leakage in translation for this gene. This mutation is rescued with the tRNA amber suppressor supD (BBa_K914000). The idea here is to prevent the kanamycin gene resistance to be expressed in case horizontal gene transfer. false false _1179_ 0 13470 9 It's complicated true I have need to design the primers that will introduce a mutation from a serine that was closer to the TAG codon (either 1, 2 or 3 mutations, here it was 1 and 2 mutations for both mutations), and it is necessary to have the amber codon in the middle of the coding sequence, not in the beginning, to be not interpreted as a alternative start codon for instance. false Jean Cury annotation2212595 1 kanamycin resistance range2212595 1 149 967 annotation2212597 1 BBa_K914009 range2212597 1 1 967 annotation2212596 1 Ser133->Amber codon range2212596 1 546 546 annotation2212599 1 Ser203->Amber mutation range2212599 1 609 610 annotation2212594 1 BBa_P1003 range2212594 1 1 967 BBa_K914018_sequence 1 ctgatccttcaactcagcaaaagttcgatttattcaacaaagccacgttgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcttgctcccgtccgcgcttaaactccaacatggacgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgcttgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtccgtctcaactggctgacggagtttatgcctctcccgaccatcaagcattttatccgtactcctgatgatgcgtggttactcaccaccgcgattcctgggaaaacagccttccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggccgtgttcctgcgccggttacattagattcctgtttgtaattgtccttttaacagcgatcgtgtatttcgtcttgctcaggcgcaatagcgcatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcacaagctcttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgggtcggaatcgcagaccgttaccaggaccttgccattctttggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z