BBa_K916004 1 BBa_K916004 Leucine Zipper CGFP translational fusion 2012-10-01T11:00:00Z 2015-05-08T01:13:46Z The CGFP fragment came from a plasmid (pMRBAD-z-NGFP) provided by Dr. Lynne Regan at Yale University. This is for use with the leucine zipper NGFP fusion (part BBa_K916003). When both protein products are expressed, they will produce fluorescence due to the dimerization of the leucine zipper domains. false false _1181_ 0 12765 9 It's complicated false This part is compatible in its current form with most biobrick assembly methods. There is no promoter or RBS with this part, so one can select the desired promoter and the strength of the RBS from other parts in the registry. false Joseph Elsherbini annotation2207140 1 NcoI site range2207140 1 1 6 annotation2207144 1 CGFP fragment range2207144 1 108 362 annotation2207143 1 leucine zipper domain range2207143 1 3 98 annotation2207141 1 zipper CGFP fusion range2207141 1 3 365 annotation2207146 1 AatII site range2207146 1 101 106 annotation2207142 1 start range2207142 1 3 5 annotation2207145 1 stop range2207145 1 363 365 BBa_K916004_sequence 1 ccatggcaagcgagcagctggaaaagaagttacaagccctggagaaaaaacttgctcagctggaatggaaaaaccaagcattggaaaaaaaactcgcgcagacgtcgggtggaagcggtaagaatggaatcaaagtgaacttcaagacccgccacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactgtacaactaaggatccggctgctaacaaagcccgaaaggaagctgagttgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z