BBa_K917004 1 BBa_K917004 nfsI nitroreductase gene from Enterobacter cloacae 2012-09-19T11:00:00Z 2015-05-08T01:13:46Z Enterobacter cloacae This is the gene (nfsI) from Enterobacter cloacae which encodes nitroreductase. This is an enzyme which reduces nitrogen containing compounds. Nitroreductases were implemented in convering nitro drugs such as metronidazole into their active form which is essential part of their toxicity.Expression of this gene in the presence of metronidazole leads to growth inhibition. This gene could possibly could be counter selectable marker. false false _1182_ 0 13775 9 It's complicated true This part includes the native ribosome binding site. false Elitsa Peeva annotation2188321 1 stop codon range2188321 1 666 668 annotation2188322 1 RBS range2188322 1 5 11 annotation2188320 1 start codon range2188320 1 15 17 BBa_K917005 1 BBa_K917005 lac promoter plus nitroreductase (nsfI) gene from Enterobacter cloacae 2012-09-19T11:00:00Z 2015-05-08T01:13:46Z Enterobacter cloacae This is the gene (nfsI) from Enterobacter cloacae which encodes nitroreductase under the control of the lac promoter.Expression of this gene in the presence of metronidazole leads to growth inhibition. This gene could possibly could be counter selectable marker. false false _1182_ 0 13775 9 It's complicated true This part includes the native ribosome binding site for nitroreductase. false Elitsa Peeva component2188419 1 BBa_K917004 component2188415 1 BBa_J33207 annotation2188415 1 BBa_J33207 range2188415 1 1 600 annotation2188419 1 BBa_K917004 range2188419 1 609 1279 BBa_J33207 1 BBa_J33207 lac promoter and lacZ 2006-10-26T11:00:00Z 2015-08-31T04:08:46Z The DNA was amplified from E. coli BL21 genomic DNA using primers based on published sequence (Genbank accession J01636, gi:146575). The annotation shown here is based on that associated with this Genbank entry. The sequence shown here is derived by sequencing the construct. This part (submitted in pSB1A2) consists of the lac promoter and lacZ' gene, encoding the N-terminal 76 amino acid residues of LacZ, sufficient to complement the lacZ-delta-M15 mutation for blue-white selection on Xgal plates. A SacI site has been introduced at the 3' end, overlapping the XbaI site of the Biobrick prefix. This is designed to be used as a cloning vector for making new biobricks. PCR primers can be designed with a SacI site in one primer and an SpeI site in the other. This removes the necessity for an excessively long non-complementary tail on one primer bearing either the full biobrick prefix or suffix. The PCR product can then be digested with SacI and SpeI for insertion into this plasmid, replacing the Plac-lacZ' cassette. Recombinant plasmids will then be white on IPTG/Xgal plates, whereas any that still contain the original insert will be blue. We have used this strategy to prepare several biobricks, including BBa_J33204, which contains the xylE gene encoding catechol-2,3-dioxygenase. (For making biobricks that contain lacZ', BBa_J33204 can be used in the same way; in this case, clones with plasmids that still contain xylE will turn yellow on addition of a drop of 10 mM catechol.) false false _63_ 0 837 63 It's complicated true Note that the SacI site overlaps the SpeI site. The Biobrick prefix ends ...TCTAGAG. When this is added to the CTC at the start of the sequence shown here, the SacI site, GAGCTC, is generated. false Chris French annotation1907857 1 rbs range1907857 1 359 362 annotation1907858 1 lacZ' range1907858 1 370 600 annotation1907854 1 SacI range1907854 1 1 3 annotation1907855 1 CAP binding site range1907855 1 248 285 annotation1907856 1 LacI binding site range1907856 1 332 352 annotation1907859 1 -10 range1907859 1 320 325 annotation1907860 1 -35 range1907860 1 297 302 BBa_K917005_sequence 1 ctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgaaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgatactagagcaccaggagttgttatggatatcatttctgtcgccctgaaacgccactctaccaaggcgttcgacgcaagcaaaaaactgaccgcggaagaagcggaaaaaatcaaaaccctgctgcaatacagcccgtccagcaccaactcccagccgtggcacttcattgtagccagcaccgaggaaggaaaagcgcgcgtggcgaagtccgctgcgggcacctatgtgttcaacgaacgcaaaatgctggatgcttcccacgtggtggtgttctgcgcgaaaaccgcgatggatgacgcctggctggagcgcgtcgtggatcaggaagaggccgatggccgtttcaacacgccggaagccaaagccgcaaaccataagggccgcacctacttcgccgacatgcaccgcgtggatctgaaagatgacgaccagtggatggcgaagcaggtttacctgaacgtcggcaacttcctgctgggcgtgggcgcgatgggtctggacgcggtaccaattgaaggtttcgacgccgctattctcgacgaagagtttggcctgaaagagaaaggcttcaccagcctggtggtggtaccggttgggcaccacagcgtggaagatttcaacgccacgctgccgaaatctcgcctgccgctgagcacgattgtgaccgagtgctaataa BBa_K917004_sequence 1 caccaggagttgttatggatatcatttctgtcgccctgaaacgccactctaccaaggcgttcgacgcaagcaaaaaactgaccgcggaagaagcggaaaaaatcaaaaccctgctgcaatacagcccgtccagcaccaactcccagccgtggcacttcattgtagccagcaccgaggaaggaaaagcgcgcgtggcgaagtccgctgcgggcacctatgtgttcaacgaacgcaaaatgctggatgcttcccacgtggtggtgttctgcgcgaaaaccgcgatggatgacgcctggctggagcgcgtcgtggatcaggaagaggccgatggccgtttcaacacgccggaagccaaagccgcaaaccataagggccgcacctacttcgccgacatgcaccgcgtggatctgaaagatgacgaccagtggatggcgaagcaggtttacctgaacgtcggcaacttcctgctgggcgtgggcgcgatgggtctggacgcggtaccaattgaaggtttcgacgccgctattctcgacgaagagtttggcctgaaagagaaaggcttcaccagcctggtggtggtaccggttgggcaccacagcgtggaagatttcaacgccacgctgccgaaatctcgcctgccgctgagcacgattgtgaccgagtgctaataa BBa_J33207_sequence 1 ctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgaaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z