BBa_K921000 1 BBa_K921000 T7 RNAP + IPTG->PoPs (Mutant I) 2012-09-30T11:00:00Z 2015-05-08T01:13:46Z The part consists of a sequences that resemble a T7 promoter and the lacO sequence found in E. coli. This is a mutant T7 promoter that includes a lacO sequence. This is repressible by the LacI protein and is induced in the presence of IPTG. The promoter sits in the 5' region of the gene of interest and initiates transcription when the cell expresses T7 RNA polymerase. Be sure you are using a cell strain that includes this gene (DE3). false false _1186_ 0 12713 9 In stock true There are three portions to the T7 promoter: the recognition site, the melting box (or TATA box) and the initation site. Mutations in these sequences caused differential behavior from the wild type. false Eric Pederson annotation2205290 1 LacO range2205290 1 19 46 annotation2205291 1 Initiation range2205291 1 19 20 annotation2205289 1 T7 promoter range2205289 1 1 19 BBa_K921000_sequence 1 taatgcgactcactataggacaattgtgggcggacaacaattccaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z