BBa_K923000 1 BBa_K923000 Primer for Thermobifida fusca cutinase 2012-09-25T11:00:00Z 2015-05-08T01:13:46Z This primer designed from Thermobifida fusca cutinase, the sequence was taken from gene bank This primer was made from Thermobifida fusca cuitnase. The use of this primer is to make cutinase gene which able to degradaing Polyethilene Terepthalate (PET). true false _1188_ 0 12718 9 Discontinued false Annealing temperature: 65 C Temperature melting (TM) : 70 false Achmad Farajallah BBa_K923000_sequence 1 aacccctacgagcgcggccccagaacgggcaggtggagcggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z