BBa_K923001 1 BBa_K923001 Forward Primer for Thermobifida fusca cutinase 2012-09-25T11:00:00Z 2015-05-08T01:13:46Z This primer designed from Thermobifida fusca cutinase, the sequence was taken from gene bank This primer was made from Thermobifida fusca cuitnase. The use of this primer is to make cutinase gene which able to degradaing Polyethilene Terepthalate (PET). false false _1188_ 0 12718 9 Not in stock false Forward primer Annealing temperature: 69 C Temperature melting (TM) : 74 C false Achmad Farajallah annotation2200423 1 TFC range2200423 1 1 21 BBa_K923001_sequence 1 aacccctacgagcgcggcccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z