BBa_K923003 1 BBa_K923003 Strong constitutive promoter 2012-09-25T11:00:00Z 2015-05-08T01:13:46Z the source of the part is from plasmid PET 14 plasmid, we get the sequence from the manual book of the plasmid product. This promoter was isolated from pET 14b plasmid (T7 promoter). This promoter was constitutive promoter. false false _1188_ 0 12677 9 It's complicated false the sequence is between restriction site of Bgl ll and Xba I false Masrukhin annotation2200611 1 T7 promoter from pET 14b plasmid range2200611 1 1 20 BBa_K923003_sequence 1 taatacgactcactataggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z