BBa_K923004 1 BBa_K923004 T7 Terminator from pET14 Plasmid 2012-09-26T11:00:00Z 2015-05-08T01:13:46Z the source of this part is from pET 14b plasmid, we get the sequence from the manual book of pET 14b plasmid product. Released HQ 2013 This terminator sequence was taken from pET 14b plasmid. false false _1188_ 0 12677 9 In stock false T7 terminator source : pET 14b plasmid false Masrukhin annotation2203343 1 misc range2203343 1 1 48 BBa_K923004_sequence 1 ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z