BBa_K925005 1 BBa_K925005 PdTagGST 2012-09-23T11:00:00Z 2015-05-08T01:13:46Z This part was biologically synthesised. This part produces functioning glutathione S-transferase (GST) protein that has a short petide sequence that binds palladium attached to the end of it. This allows the part to function as a palladium scavenger as the GST end can be bound to GST beads, while the Palladium binding end is free to bind to any free Pd in solution. false false _1190_ 0 12795 9 It's complicated false When designing the sequence for this part we had to consider the vector we would use as we required one that already contained GST. This allowed us to design primers that would anneal to each other to make the short peptide sequence and use this as our insert. false Michael Paul Lockhart BBa_K925005_sequence 1 atgattgatctgtattttgcgccgaccccgaacggccataaaattaccctgtttctggaagaagcgggcctggattatcgcctgattaaagtggatctgggcaaaggcggccagtttcgcccggaatttctgcgcattagcccgaacaacaaaattccggcgattgtggatcatagcccggcggatggcggcgaaccgctgagcctgtttgaaagcggcgcgattctgctgtatctggcggaaaaaaccggcctgtttctgagccatgaaacccgcgaacgcgcggtgaccctgcagtggctgttttggcaggtgggcggcctgggcccgatgctgggccagaaccatcattttaaccatgcggcgccgcagaccattccgtatgcgattgaacgctatcaggtggaaacccagcgcctgtatcatgtgctgaacaaacgcctggaaaacagcccgtggctgggcggcgaaaactatagcattgcggatattgcgtgctggccgtgggtgaacgcgtggacccgccagcgcattgatctggcgatgtatccggcggtgaaaaactggcatgaacgcattcgcagccgcccggcgaccggcctggcgctgctgaaagcgcagcatggcgatgaacgcagcgatagcagcgtgacccagaacaaatat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z