BBa_K925006 1 BBa_K925006 My Precious 2012-09-23T11:00:00Z 2015-05-08T01:13:46Z This part is biologically synthesised. This is a synthetically designed protein that is able to bind a mixture gold, silver, aluminium and titanium. Its design was based around hijacking myoglobin's structure and replacing the loops and turns with our own metal binding peptides. This gave us a truly synthetic part for the registry. false false _1190_ 0 12795 9 It's complicated false When designing this part we based it around an existing protein, myoglobin, which had short α-helices and β-sheets. This allowed us to hijack the loops and turns of the myoglobin protein and inset our own metal binding sites. Some changes to the protein sequence was required as we used gBlocks^TM which are a maximum of 500 base pairs in length. false Michael Paul Lockhart BBa_K925006_sequence 1 gtttctggttcttctccggactctgcgctgggcggcattctgaaaaaaggccatcatgaagcggaaattaaagcgtactcttctggtgcgccgccgatgccgccgttcctggaatttatttccgaatgcattattcaggttccgtcttctggtccgcaggacacccgtaccaccgcggatgcgcagggcgcgatgaataaagcgctggaactgtttcgtaaagatatggcgtccgtaaactgccggacgcgccgggtatgcacacctggtccgaagatgaaatgaaagcgtccgaagatctgaaaaaacatggcgcgaccggtacctctgttctgatcgcgaccccgtacgtttccatgcagctgtcccagctggaaggcattatccgtccggcgatccacatcatcccgatctctcactccatgcagctgtcccagctggaaggcattcatcatcaccatcaccacctcgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z