BBa_K929002 1 BBa_K929002 modified AID with CMV and hGH-polyA 2012-09-17T11:00:00Z 2015-05-08T01:13:46Z 3 other Biobricks: CMV promoter (BBa_I712004), superAID (BBa_K929001) and hGH polyadenylation signal sequence (BBa_K404108). Released HQ 2013 The BioBrick wtAID is an extended version of the existing AID BioBrick (BBa_K929001). It is built of 3 parts: CMV promoter (BBa_I712004), superAID and hGH polyadenylation signal sequence (BBa_K404108).<br> AID:<br> AID is known to be responsible for somatic hypermutation and the class-switch recombination of immunoglobulin in B cells. This enzyme of 28 kDa originally occurs in B cells but does also show activity after transfection into CHO cells. AID induces the deamination of cytidine to uridine at actively transcribed single strand DNA. The replacement of cytidine by uridine leads to a mismatch during DNA replication and integrates a single base substitution predominantly in the immunoglobulin genes. <br> The AID motif is naturally terminated with the Nuclear Export Sequence (NES) that causes the protein to translocate from the nucleus to the cytoplasm. Additionally, upstream, dysfunctional Nuclear Localization Sequence (NLS) is located. Due to the fact that AID mutates the actively transcribed single stranded DNA, it is supposed that the direction of the enzyme to the inside of the nucleus would improve the mutation rate. That is why we called it superAID<br> Functional NLS sequence:<br> This part of the BioBrick directs the expressed protein into the nucleus, where it can mutate stronger. <br> Kozak sequence<br> Kozak consensus sequence is added upstream of the AID mutant to express the protein stronger.<br> CMV promoter:<br> CMV stands for cytomegalovirus. The CMV promoter is commonly used due to its very strong activity, and effectivity in a broad range of cell types. The BioBrick is therefore improved via addition of the strong promoter.<br> hGH polyadenylation signal sequence:<br> Polyadenylation is a significant part for the translation and stability of mRNA. In eukaryotes, it is part of the process that produces mature messenger RNA (mRNA) for translation. It, therefore, forms part of the larger process of gene expression. hGH terminator gives a signal to start polyadenylation in the translation process. false false _1194_ 0 14457 9 In stock false blaa bla false Potsdam Bioware 2012 iGEM annotation2184468 1 CMV promoter range2184468 1 1 654 annotation2184474 1 hGH terminator range2184474 1 1259 1736 annotation2184475 1 BBa_K404108 range2184475 1 1259 1736 annotation2184472 1 mod. AID range2184472 1 696 1250 annotation2193793 1 AUG range2193793 1 671 673 annotation2193794 1 UAA range2193794 1 1247 1249 annotation2184473 1 BBa_K929001 range2184473 1 663 1249 annotation2196257 1 AgeI range2196257 1 1241 1246 annotation2184469 1 BBa_I712004 range2184469 1 1 654 annotation2184470 1 Kozak sequence range2184470 1 663 677 annotation2184471 1 NLS sequence range2184471 1 678 695 BBa_K929002_sequence 1 cgatgtacgggccagatatacgcgttgacattgattattgcctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattactagagccgccaccatgggacccaagaagaggaaggtgatggacagcctcttgatgaaccggaggaagtttctttaccaattcaaaaatgtccgctgggctaagggtcggcgtgagacctacctgtgctacgtagtgaagaggcgtgacagtgctacatccttttcactggactttggttatcttcgcaataagaacggctgccacgtggaattgctcttcctccgctacatctcggactgggacctagaccctggccgctgctaccgcgtcacctggttcacctcctggagcccctgctacgactgtgcccgacatgtggccgactttctgcgagggaaccccaacctcagtctgaggatcttcaccgcgcgcctctacttctgtgaggaccgcaaggctgagcccgaggggctgcggcggctgcaccgcgccggggtgcaaatagccatcatgaccttcaaagattatttttactgctggaatacttttgtagaaaaccatgaaagaactttcaaagcctgggaagggctgcatgaaaattcagttcgtctctccagacagcttcggcgcatccttttgcccaccggttaatactagagacgggtggcatccctgtgacccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagccttgtcctaataaaattaagttgcatcattttgtctgactaggtgtccttctataatattatggggtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtagggcctgcggggtctattgggaaccaagctggagtgcagtggcacaatcttggctcactgcaatctccgcctcctgggttcaagcgattctcctgcctcagcctcccgagttgttgggattccaggcatgcatgaccaggctcagctaatttttgtttttttggtagagacggggtttcaccatattggccaggctggtctccaactcctaatctcaggtgatctacccaccttggcctcccaaattgctgggattacaggcgtgaaccactgctcccttccctgtcctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z