BBa_K929104 1 BBa_K929104 Anti-GFP Nanobody 2012-09-23T11:00:00Z 2015-05-08T01:13:47Z Nanobody: anti-GFP nanobody taken from Protein Data Bank(PDB: 3OGO), gene synthesis by GeneArt, optimized for expression in CHO cells (Cricetulus griseus) The green fluorescent protein (GFP)-nanobody is a single-chain VHH antibody domain developed with specific binding activity against GFP and shows a Kd value of 1.4 nM. Its CDR3 loop is very short and has significantly fewer contacts with the GFP ligand compared to other nanobodies. Furthermore, the shortness of this CDR3 loop leads to the exposure of the framework 2 region, which has a major contribution to the binding with GFP. false false _1194_ 0 14271 9 In stock false Gene synthesis by GeneArt, optimized for expression in CHO cells (Cricetulus griseus). false Potsdam Bioware 2012 iGEM annotation2195308 1 anti-GFP nanobody range2195308 1 1 348 BBa_K929104_sequence 1 caggtgcagctggtggaatctggtggtgccctggtgcagcctggcggctctctgagactgtcttgtgccgcctctggcttccccgtgaacagatactccatgcggtggtacagacaggcccctggcaaagaacgcgagtgggtggccggaatgtcctccgctggcgacagatcctcctacgaggactccgtgaagggccggttcaccatctctcgggacgacgccagaaacaccgtgtacctccagatgaactccctgaagcccgaggacaccgccgtgtactactgcaacgtgaacgtgggcttcgagtactggggccagggcacacaagtgaccgtgtcctccaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z