BBa_K929302 1 BBa_K929302 AID in Potsdam Standard 2012-09-23T11:00:00Z 2015-05-08T01:13:47Z BBa_K103001 Released HQ 2013 AID is known to be responsible for somatic hypermutation and the class-switch recombination of immunoglobulin in B cells. This enzyme of 28 kDa originally occurs in B cells but does also show activity after transfection into CHO cells. AID induces the deamination of cytidine to uridine at actively transcribed single strand DNA. The replacement of cytidine by uridine leads to a mismatch during DNA replication and integrates a single base substitution predominantly in the immunoglobulin genes. false false _1194_ 0 14525 9 In stock false AID was amplified with primers which contains thiophosphates at 5' end and insert in Potsdam Standard Backbone using PLIcing method. false Potsdam Bioware 2012 iGEM annotation2195668 1 AID range2195668 1 9 606 BBa_K929302_sequence 1 gggcctccatggacagcctcttgatgaaccggaggaagtttctttaccaattcaaaaatgtccgctgggctaagggtcggcgtgagacctacctgtgctacgtagtgaagaggcgtgacagtgctacatccttttcactggactttggttatcttcgcaataagaacggctgccacgtggaattgctcttcctccgctacatctcggactgggacctagaccctggccgctgctaccgcgtcacctggttcacctcctggagcccctgctacgactgtgcccgacatgtggccgactttctgcgagggaaccccaacctcagtctgaggatcttcaccgcgcgcctctacttctgtgaggaccgcaaggctgagcccgaggggctgcggcggctgcaccgcgccggggtgcaaatagccatcatgaccttcaaagattatttttactgctggaatacttttgtagaaaaccatgaaagaactttcaaagcctgggaagggctgcatgaaaattcagttcgtctctccagacagcttcggcgcatccttttgcccctgtatgaggttgatgacttacgagacgcatttcgtactttgggactttgaatcatgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z