BBa_K931000 1 BBa_K931000 Starch Binding Protein (SBP) 2012-09-26T11:00:00Z 2015-05-08T01:13:47Z R. Oryzae, genomic DNA Starch binding protein, also known as Starch binding domain, is a protein from the gene CBM 21 of the organism, R. oryzae. Its functional purpose is to aid starch breakdown by binding to starch and providing an optimal interaction with the amylytic enzymes. Its substrates are diverse among the carbohydrate family. It has a high affinity for rice starch, corn starch, sweet potato starch, tapioca starch, and also wheat starch. false false _1196_ 0 13008 9 In stock false N/A false Joe Alexander BBa_K931000_sequence 1 gaattcgcggccgcttctagaatggcatcgattccgagcagcgcgtccgttcagctggatagctacaactatgacggtagcaccttctccggtaaaatctacgtgaagaacattgcgtatagcaagaaagtgacggtcgtttatgctgatggttctgacaattggaataacaatggtaacatcattgcggccagcttcagcggtccgatttccggcagcaattatgagtactggacgtttagcgcaagcgttaagggcatcaaagagttttacatcaagtacgaagtcagcggcaaaacctattacgacaataacaatagcgcgaactaccaagtgtctaccactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z